Incidental Mutation 'R7353:Mia3'
ID570707
Institutional Source Beutler Lab
Gene Symbol Mia3
Ensembl Gene ENSMUSG00000056050
Gene Namemelanoma inhibitory activity 3
Synonyms9130229H14Rik, B230399H06Rik, LOC385255, A930039G15Rik, Tango
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7353 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location183326725-183369553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 183327392 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 446 (A446D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109158] [ENSMUST00000109166] [ENSMUST00000193625]
Predicted Effect
SMART Domains Protein: ENSMUSP00000064801
Gene: ENSMUSG00000056050
AA Change: A446D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SH3 48 106 2.78e-2 SMART
low complexity region 138 147 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 767 774 N/A INTRINSIC
coiled coil region 1240 1329 N/A INTRINSIC
coiled coil region 1362 1427 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
coiled coil region 1517 1565 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109158
AA Change: A765D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104786
Gene: ENSMUSG00000056050
AA Change: A765D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
SCOP:d1fxkc_ 159 274 2e-4 SMART
low complexity region 281 294 N/A INTRINSIC
SCOP:d1fxkc_ 365 463 1e-3 SMART
low complexity region 482 498 N/A INTRINSIC
low complexity region 557 567 N/A INTRINSIC
low complexity region 609 626 N/A INTRINSIC
low complexity region 635 661 N/A INTRINSIC
low complexity region 665 680 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109166
SMART Domains Protein: ENSMUSP00000104795
Gene: ENSMUSG00000042901

DomainStartEndE-ValueType
Pfam:Aida_N 9 112 1.9e-43 PFAM
low complexity region 122 144 N/A INTRINSIC
Pfam:Aida_C2 155 300 2.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193625
SMART Domains Protein: ENSMUSP00000141649
Gene: ENSMUSG00000042901

DomainStartEndE-ValueType
Pfam:Aida_N 8 113 2.3e-49 PFAM
low complexity region 122 144 N/A INTRINSIC
Pfam:Aida_C2 145 219 6.4e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous null for the large isoform display complete perinatal lethality with impaired collagen secretion, intracellular collagen aggregates, short limbed dwarfism, and arrest of chondrocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Mia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1037:Mia3 UTSW 1 183357354 missense probably benign 0.06
R1489:Mia3 UTSW 1 183338674 missense probably benign
R1997:Mia3 UTSW 1 183344286 missense possibly damaging 0.72
R2261:Mia3 UTSW 1 183334793 missense probably benign 0.00
R2263:Mia3 UTSW 1 183334793 missense probably benign 0.00
R2334:Mia3 UTSW 1 183334402 critical splice donor site probably null
R3417:Mia3 UTSW 1 183362100 missense probably damaging 1.00
R3872:Mia3 UTSW 1 183356998 missense probably benign 0.04
R3943:Mia3 UTSW 1 183358783 missense possibly damaging 0.54
R4398:Mia3 UTSW 1 183330878 missense probably damaging 1.00
R4746:Mia3 UTSW 1 183345220 missense possibly damaging 0.80
R4814:Mia3 UTSW 1 183332830 missense probably damaging 0.98
R4975:Mia3 UTSW 1 183331115 missense probably benign 0.02
R5104:Mia3 UTSW 1 183338132 missense probably damaging 0.98
R5174:Mia3 UTSW 1 183331493 nonsense probably null
R5272:Mia3 UTSW 1 183328270 nonsense probably null
R5445:Mia3 UTSW 1 183336022 missense probably benign 0.06
R5651:Mia3 UTSW 1 183358654 missense probably damaging 1.00
R5852:Mia3 UTSW 1 183332859 missense probably benign 0.01
R6246:Mia3 UTSW 1 183345277 missense probably damaging 0.99
R6565:Mia3 UTSW 1 183331485 missense probably damaging 1.00
R7378:Mia3 UTSW 1 183334775 missense probably benign 0.01
R7417:Mia3 UTSW 1 183327653 missense
R7442:Mia3 UTSW 1 183358876 missense probably benign 0.03
R7552:Mia3 UTSW 1 183365695 nonsense probably null
R7959:Mia3 UTSW 1 183344339 missense probably damaging 1.00
R8147:Mia3 UTSW 1 183328207 missense
Predicted Primers PCR Primer
(F):5'- AGGCCATGGAAATACGTGTTC -3'
(R):5'- AGGTGTTCTGCCTGGGAAAC -3'

Sequencing Primer
(F):5'- CGTGTTCTTAAAGCATTTCCACAGG -3'
(R):5'- GATCCTCGGGAATTTTTACCAGGAC -3'
Posted On2019-09-13