Mutagenetix > Incidental Mutation

Incidental Mutation 'R7353:Cenpf'

570708

Institutional Source

Beutler Lab

Gene Symbol

Cenpf

Ensembl Gene

ENSMUSG00000026605

Gene Name

centromere protein F

Synonyms

mitosin, 6530404A22Rik, Lek1

MMRRC Submission

045439-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.433) question?

Stock #

R7353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

189640606-189688086 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 189654138 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1982 (K1982*)

Ref Sequence

ENSEMBL: ENSMUSP00000129738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165962] [ENSMUST00000171929]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000165962

SMART Domains

Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	300	7.3e-135	PFAM
low complexity region	332	347	N/A	INTRINSIC
low complexity region	361	379	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
low complexity region	572	592	N/A	INTRINSIC
internal_repeat_1	737	759	3.18e-5	PROSPERO
internal_repeat_1	751	773	3.18e-5	PROSPERO
internal_repeat_2	789	804	5.94e-5	PROSPERO
coiled coil region	812	864	N/A	INTRINSIC
coiled coil region	885	923	N/A	INTRINSIC
low complexity region	925	936	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171929
AA Change: K1982*

SMART Domains

Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: K1982*

Domain	Start	End	E-Value	Type
Pfam:CENP-F_N	1	300	2.8e-144	PFAM
low complexity region	349	364	N/A	INTRINSIC
low complexity region	378	396	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	589	609	N/A	INTRINSIC
internal_repeat_5	678	707	8.32e-5	PROSPERO
internal_repeat_3	743	798	2.21e-5	PROSPERO
internal_repeat_1	780	812	2.12e-7	PROSPERO
coiled coil region	829	881	N/A	INTRINSIC
coiled coil region	902	1169	N/A	INTRINSIC
coiled coil region	1206	1364	N/A	INTRINSIC
internal_repeat_2	1381	1413	3.02e-6	PROSPERO
internal_repeat_3	1412	1470	2.21e-5	PROSPERO
low complexity region	1526	1542	N/A	INTRINSIC
coiled coil region	1560	1650	N/A	INTRINSIC
internal_repeat_2	1655	1687	3.02e-6	PROSPERO
low complexity region	1744	1755	N/A	INTRINSIC
coiled coil region	1822	1852	N/A	INTRINSIC
Pfam:CENP-F_leu_zip	1893	2035	1.2e-14	PFAM
Pfam:CENP-F_leu_zip	2131	2270	1.5e-47	PFAM
Pfam:CENP-F_leu_zip	2313	2449	1e-46	PFAM
low complexity region	2544	2555	N/A	INTRINSIC
low complexity region	2642	2654	N/A	INTRINSIC
low complexity region	2755	2769	N/A	INTRINSIC
internal_repeat_4	2778	2801	4.28e-5	PROSPERO
low complexity region	2837	2847	N/A	INTRINSIC
Pfam:CENP-F_C_Rb_bdg	2850	2896	6.6e-29	PFAM
internal_repeat_1	2935	2964	2.12e-7	PROSPERO
internal_repeat_4	2946	2969	4.28e-5	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110070M22Rik	C	A	13: 119,488,178	A11S	unknown	Het
Aadacl4	G	A	4: 144,617,920	V89I	probably damaging	Het
Abcc9	T	A	6: 142,601,005	I1369F	probably damaging	Het
Adgrf3	T	A	5: 30,198,497	I427F	probably damaging	Het
Alox12e	T	C	11: 70,321,435	Y139C	probably damaging	Het
Arhgef2	T	A	3: 88,635,686	V397E	possibly damaging	Het
Arhgef28	T	A	13: 98,075,202	Y91F	probably damaging	Het
Bcar3	A	G	3: 122,512,692	T454A	probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Boc	C	T	16: 44,485,737	V1070M	unknown	Het
Ccdc88a	T	A	11: 29,463,368	N635K	probably benign	Het
Ccr2	T	C	9: 124,106,756	S358P	probably damaging	Het
Ccser2	T	C	14: 36,941,143	Q28R	possibly damaging	Het
Csn1s2a	A	T	5: 87,785,302	I137F	possibly damaging	Het
Cttnbp2	A	T	6: 18,375,944	I1532K	possibly damaging	Het
Dnajc13	C	A	9: 104,230,031	R304L	possibly damaging	Het
Dopey1	T	A	9: 86,512,859	M664K	probably damaging	Het
Emilin3	T	A	2: 160,908,821	E336V	probably damaging	Het
Eml5	A	G	12: 98,825,424	Y63H		Het
Fbxo41	G	T	6: 85,479,976	R404S	possibly damaging	Het
Gm8897	G	A	5: 11,416,436	D7N	possibly damaging	Het
Gpr155	A	T	2: 73,367,491	Y456*	probably null	Het
Gpr156	T	A	16: 37,992,161	N286K	probably damaging	Het
Kcna5	A	G	6: 126,534,845	S107P	probably benign	Het
Kcne2	A	T	16: 92,296,822	H79L	possibly damaging	Het
Kcnh4	T	A	11: 100,757,199	M113L	probably benign	Het
Lad1	T	A	1: 135,827,775	L263Q	probably damaging	Het
Lctl	G	A	9: 64,126,967	G296D	probably damaging	Het
Lmtk3	A	T	7: 45,788,000	I205F	possibly damaging	Het
Magel2	G	T	7: 62,379,331	R661L	unknown	Het
Mcm10	G	A	2: 5,007,109	P180S	possibly damaging	Het
Mia3	G	T	1: 183,327,392	A446D		Het
N4bp2	G	A	5: 65,806,371	V588M	probably benign	Het
Naip6	C	T	13: 100,299,751	V755M	probably benign	Het
Neurl1a	T	C	19: 47,240,660	V213A	probably damaging	Het
Nrd1	A	G	4: 109,039,749	T522A	probably damaging	Het
Ntng1	T	C	3: 110,135,447	Q21R	probably damaging	Het
Nup160	T	C	2: 90,703,952	L707S	probably damaging	Het
Oas2	A	T	5: 120,738,522	V452D	probably damaging	Het
Olfr3	A	G	2: 36,812,903	L63P	probably damaging	Het
Olfr350	A	T	2: 36,850,069	M8L	probably benign	Het
Olfr351	G	A	2: 36,859,668	R227*	probably null	Het
Olfr519	A	G	7: 108,894,222	F67L	probably damaging	Het
Olfr593	A	C	7: 103,212,309	T150P	probably damaging	Het
Plekhg1	A	T	10: 3,964,327	T1405S		Het
Pnrc1	G	A	4: 33,248,300	P33L	probably damaging	Het
Prkag2	A	T	5: 24,880,686	V312E	possibly damaging	Het
Rps17	T	A	7: 81,344,345	E76V	possibly damaging	Het
Rsph10b	G	A	5: 143,967,220	G672S	possibly damaging	Het
Slc2a13	T	C	15: 91,321,604	N460S	probably benign	Het
Slco2b1	A	T	7: 99,690,557	C56S	possibly damaging	Het
Spn	T	C	7: 127,137,006	T110A	probably benign	Het
Sult2a8	T	C	7: 14,413,715	N217S	possibly damaging	Het
Tbx2	C	A	11: 85,833,489	T128N	probably damaging	Het
Tecpr2	A	T	12: 110,967,844	M1313L	probably benign	Het
Tmc2	G	A	2: 130,196,577		probably null	Het
Tstd1	G	T	1: 171,419,955	A69S	probably damaging	Het
Txnrd3	A	G	6: 89,661,585	D252G	probably benign	Het
Ulk2	T	C	11: 61,819,348	N345D	probably damaging	Het
Unc13c	T	C	9: 73,574,073	D1694G	probably benign	Het
Vill	T	C	9: 119,065,493	V406A	probably damaging	Het
Vmn2r115	T	C	17: 23,345,913	V258A	possibly damaging	Het
Vmn2r82	T	A	10: 79,396,618	M817K	probably benign	Het
Xpnpep3	T	C	15: 81,430,887	S263P	probably benign	Het
Zfp980	A	G	4: 145,702,144	D481G	probably benign	Het
Zmpste24	A	G	4: 121,095,581	S81P	probably damaging	Het
Znrf4	A	G	17: 56,512,169	V46A	probably benign	Het

Other mutations in Cenpf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cenpf	APN	1	189654912	missense	probably benign	0.01
IGL01154:Cenpf	APN	1	189680333	missense	probably benign	0.19
IGL01434:Cenpf	APN	1	189657868	nonsense	probably null
IGL01461:Cenpf	APN	1	189657096	missense	probably damaging	1.00
IGL01615:Cenpf	APN	1	189653184	missense	possibly damaging	0.68
IGL01720:Cenpf	APN	1	189682386	missense	probably benign	0.05
IGL01720:Cenpf	APN	1	189651215	missense	probably damaging	0.99
IGL01803:Cenpf	APN	1	189654771	nonsense	probably null
IGL02152:Cenpf	APN	1	189649012	missense	probably benign
IGL02222:Cenpf	APN	1	189654444	missense	probably benign
IGL02338:Cenpf	APN	1	189680418	missense	probably damaging	1.00
IGL02580:Cenpf	APN	1	189657441	missense	probably benign	0.20
IGL02629:Cenpf	APN	1	189652334	missense	probably damaging	1.00
IGL02650:Cenpf	APN	1	189652473	missense	possibly damaging	0.91
IGL02660:Cenpf	APN	1	189654782	missense	probably damaging	1.00
IGL02703:Cenpf	APN	1	189659758	missense	probably benign	0.14
IGL02809:Cenpf	APN	1	189682358	splice site	probably benign
IGL02851:Cenpf	APN	1	189658030	missense	probably damaging	1.00
IGL02903:Cenpf	APN	1	189646876	missense	probably damaging	0.99
IGL03126:Cenpf	APN	1	189659010	missense	probably damaging	1.00
IGL03235:Cenpf	APN	1	189683927	missense	probably damaging	1.00
IGL03336:Cenpf	APN	1	189652647	missense	probably damaging	0.99
IGL03402:Cenpf	APN	1	189655076	missense	probably damaging	1.00
IGL02799:Cenpf	UTSW	1	189659652	missense	probably damaging	1.00
R0011:Cenpf	UTSW	1	189650706	missense	probably benign	0.05
R0129:Cenpf	UTSW	1	189659650	missense	probably benign	0.26
R0157:Cenpf	UTSW	1	189652359	missense	probably benign	0.07
R0270:Cenpf	UTSW	1	189650714	missense	probably benign	0.01
R0607:Cenpf	UTSW	1	189682463	splice site	probably null
R0621:Cenpf	UTSW	1	189672628	missense	probably benign
R0639:Cenpf	UTSW	1	189658062	missense	probably benign	0.01
R0653:Cenpf	UTSW	1	189659986	missense	probably damaging	1.00
R0718:Cenpf	UTSW	1	189653984	missense	probably damaging	1.00
R1157:Cenpf	UTSW	1	189658453	missense	probably benign	0.20
R1331:Cenpf	UTSW	1	189642801	missense	probably damaging	0.99
R1463:Cenpf	UTSW	1	189654739	missense	probably damaging	0.97
R1514:Cenpf	UTSW	1	189679141	missense	possibly damaging	0.67
R1529:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1574:Cenpf	UTSW	1	189652713	missense	probably damaging	1.00
R1662:Cenpf	UTSW	1	189657771	missense	probably damaging	0.99
R1671:Cenpf	UTSW	1	189679144	splice site	probably null
R1725:Cenpf	UTSW	1	189680479	missense	probably damaging	0.99
R1743:Cenpf	UTSW	1	189654263	missense	probably benign	0.19
R1874:Cenpf	UTSW	1	189683816	missense	probably damaging	1.00
R1884:Cenpf	UTSW	1	189646849	missense	probably benign
R1980:Cenpf	UTSW	1	189653915	missense	probably benign	0.04
R2074:Cenpf	UTSW	1	189656901	missense	probably damaging	1.00
R2096:Cenpf	UTSW	1	189653459	missense	possibly damaging	0.95
R2109:Cenpf	UTSW	1	189679067	missense	probably damaging	0.99
R2113:Cenpf	UTSW	1	189679102	missense	probably damaging	0.96
R2134:Cenpf	UTSW	1	189658642	missense	probably benign	0.03
R2209:Cenpf	UTSW	1	189652598	missense	probably benign	0.04
R2875:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R2876:Cenpf	UTSW	1	189658644	missense	probably benign	0.11
R3433:Cenpf	UTSW	1	189659949	missense	probably damaging	0.99
R3709:Cenpf	UTSW	1	189648812	missense	possibly damaging	0.72
R3786:Cenpf	UTSW	1	189658337	missense	probably damaging	1.00
R4014:Cenpf	UTSW	1	189653159	missense	probably benign	0.01
R4108:Cenpf	UTSW	1	189683868	missense	probably damaging	1.00
R4119:Cenpf	UTSW	1	189653045	missense	probably benign	0.01
R4177:Cenpf	UTSW	1	189668619	missense	possibly damaging	0.95
R4422:Cenpf	UTSW	1	189658350	missense	probably damaging	1.00
R4546:Cenpf	UTSW	1	189654650	missense	probably damaging	1.00
R4592:Cenpf	UTSW	1	189679033	missense	probably damaging	1.00
R4643:Cenpf	UTSW	1	189659589	missense	probably benign	0.00
R4650:Cenpf	UTSW	1	189660038	missense	probably benign	0.00
R4801:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4802:Cenpf	UTSW	1	189651220	missense	probably damaging	1.00
R4817:Cenpf	UTSW	1	189682369	missense	possibly damaging	0.93
R4871:Cenpf	UTSW	1	189658531	missense	probably damaging	1.00
R5037:Cenpf	UTSW	1	189683846	missense	probably damaging	1.00
R5106:Cenpf	UTSW	1	189683808	missense	probably benign	0.00
R5208:Cenpf	UTSW	1	189671046	critical splice donor site	probably null
R5213:Cenpf	UTSW	1	189654980	missense	probably benign	0.04
R5237:Cenpf	UTSW	1	189659533	missense	probably benign	0.28
R5255:Cenpf	UTSW	1	189672627	missense	possibly damaging	0.49
R5378:Cenpf	UTSW	1	189653466	missense	possibly damaging	0.95
R5468:Cenpf	UTSW	1	189652371	missense	probably damaging	1.00
R5510:Cenpf	UTSW	1	189682903	missense	probably benign	0.14
R5616:Cenpf	UTSW	1	189657286	missense	probably damaging	1.00
R5652:Cenpf	UTSW	1	189657082	missense	probably damaging	0.99
R5735:Cenpf	UTSW	1	189654363	missense	probably benign	0.10
R5841:Cenpf	UTSW	1	189657444	missense	possibly damaging	0.90
R5943:Cenpf	UTSW	1	189659969	missense	possibly damaging	0.75
R6082:Cenpf	UTSW	1	189658104	missense	probably benign	0.11
R6108:Cenpf	UTSW	1	189662013	missense	probably benign	0.03
R6269:Cenpf	UTSW	1	189659920	missense	probably benign	0.37
R6284:Cenpf	UTSW	1	189652742	missense	probably damaging	1.00
R6425:Cenpf	UTSW	1	189659898	missense	probably benign	0.09
R6587:Cenpf	UTSW	1	189658374	missense	probably damaging	1.00
R6747:Cenpf	UTSW	1	189652854	missense	probably benign	0.15
R6811:Cenpf	UTSW	1	189654542	missense	probably benign	0.06
R6834:Cenpf	UTSW	1	189659446	missense	probably damaging	1.00
R6951:Cenpf	UTSW	1	189653792	missense	probably damaging	1.00
R7095:Cenpf	UTSW	1	189659176	missense	probably benign	0.01
R7128:Cenpf	UTSW	1	189684991	missense	probably damaging	1.00
R7185:Cenpf	UTSW	1	189653489	missense	probably damaging	1.00
R7292:Cenpf	UTSW	1	189650694	missense	probably damaging	1.00
R7402:Cenpf	UTSW	1	189659378	nonsense	probably null
R7460:Cenpf	UTSW	1	189654050	missense	probably damaging	0.97
R7484:Cenpf	UTSW	1	189656821	missense	probably damaging	1.00
R7574:Cenpf	UTSW	1	189658667	missense	probably damaging	1.00
R7691:Cenpf	UTSW	1	189658207	nonsense	probably null
R7698:Cenpf	UTSW	1	189662072	missense	probably benign	0.01
R7901:Cenpf	UTSW	1	189657248	missense	probably damaging	1.00
R7941:Cenpf	UTSW	1	189657286	missense	probably damaging	1.00
R8007:Cenpf	UTSW	1	189646947	missense
R8194:Cenpf	UTSW	1	189682403	missense	probably benign	0.06
R8420:Cenpf	UTSW	1	189672585	missense	probably damaging	1.00
R8429:Cenpf	UTSW	1	189657307	missense	possibly damaging	0.72
R8477:Cenpf	UTSW	1	189653188	missense	probably benign
R8492:Cenpf	UTSW	1	189658729	missense	probably damaging	0.99
R8510:Cenpf	UTSW	1	189650706	missense	probably benign	0.01
R8686:Cenpf	UTSW	1	189659604	missense	probably benign	0.00
R8696:Cenpf	UTSW	1	189657997	missense	probably benign	0.20
R8855:Cenpf	UTSW	1	189653233	missense	probably benign	0.11
R8901:Cenpf	UTSW	1	189662051	missense	probably benign	0.30
R8958:Cenpf	UTSW	1	189653153	missense	possibly damaging	0.81
R9109:Cenpf	UTSW	1	189659374	missense	probably benign	0.06
R9135:Cenpf	UTSW	1	189672549	missense	probably damaging	1.00
R9136:Cenpf	UTSW	1	189671155	missense	probably benign	0.02
R9198:Cenpf	UTSW	1	189656790	missense	probably damaging	1.00
R9240:Cenpf	UTSW	1	189656970	missense	probably benign	0.01
R9303:Cenpf	UTSW	1	189660074	critical splice acceptor site	probably null
R9305:Cenpf	UTSW	1	189660074	critical splice acceptor site	probably null
R9354:Cenpf	UTSW	1	189646917	missense
R9502:Cenpf	UTSW	1	189656781	missense	probably damaging	1.00
R9619:Cenpf	UTSW	1	189653768	missense	probably benign	0.01
RF006:Cenpf	UTSW	1	189657386	missense	probably damaging	1.00
X0025:Cenpf	UTSW	1	189653874	missense	possibly damaging	0.79
X0066:Cenpf	UTSW	1	189657929	missense	probably benign	0.23
Z1088:Cenpf	UTSW	1	189652931	missense	probably damaging	1.00
Z1176:Cenpf	UTSW	1	189659472	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTATTTCCAGCTCACCAATCG -3'
(R):5'- AACTTAGAGGTGGTTCAAGCAG -3'

Sequencing Primer
(F):5'- CGCCAAAGATAATTCTTGTGAGTC -3'
(R):5'- TGGTTCAAGCAGAGAAGCTC -3'

Posted On

2019-09-13