Incidental Mutation 'R7353:Or1n1'
ID 570712
Institutional Source Beutler Lab
Gene Symbol Or1n1
Ensembl Gene ENSMUSG00000075383
Gene Name olfactory receptor family 1 subfamily N member 1
Synonyms Olfr351, MOR127-2, GA_x6K02T2NLDC-33554926-33553994
MMRRC Submission 045439-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 36749426-36750358 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 36749680 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 227 (R227*)
Ref Sequence ENSEMBL: ENSMUSP00000149369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100150] [ENSMUST00000213676] [ENSMUST00000215137]
AlphaFold Q8VGK1
Predicted Effect probably null
Transcript: ENSMUST00000100150
AA Change: R227*
SMART Domains Protein: ENSMUSP00000097727
Gene: ENSMUSG00000075383
AA Change: R227*

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.7e-56 PFAM
Pfam:7tm_1 39 288 5.3e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213676
AA Change: R227*
Predicted Effect probably null
Transcript: ENSMUST00000215137
AA Change: R227*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,624,714 (GRCm39) A11S unknown Het
Aadacl4 G A 4: 144,344,490 (GRCm39) V89I probably damaging Het
Abcc9 T A 6: 142,546,731 (GRCm39) I1369F probably damaging Het
Adgrf3 T A 5: 30,403,495 (GRCm39) I427F probably damaging Het
Alox12e T C 11: 70,212,261 (GRCm39) Y139C probably damaging Het
Arhgef2 T A 3: 88,542,993 (GRCm39) V397E possibly damaging Het
Arhgef28 T A 13: 98,211,710 (GRCm39) Y91F probably damaging Het
Bcar3 A G 3: 122,306,341 (GRCm39) T454A probably benign Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Boc C T 16: 44,306,100 (GRCm39) V1070M unknown Het
Ccdc88a T A 11: 29,413,368 (GRCm39) N635K probably benign Het
Ccr2 T C 9: 123,906,793 (GRCm39) S358P probably damaging Het
Ccser2 T C 14: 36,663,100 (GRCm39) Q28R possibly damaging Het
Cenpf T A 1: 189,386,335 (GRCm39) K1982* probably null Het
Csn1s2a A T 5: 87,933,161 (GRCm39) I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,943 (GRCm39) I1532K possibly damaging Het
Dnajc13 C A 9: 104,107,230 (GRCm39) R304L possibly damaging Het
Dop1a T A 9: 86,394,912 (GRCm39) M664K probably damaging Het
Emilin3 T A 2: 160,750,741 (GRCm39) E336V probably damaging Het
Eml5 A G 12: 98,791,683 (GRCm39) Y63H Het
Fbxo41 G T 6: 85,456,958 (GRCm39) R404S possibly damaging Het
Gpr155 A T 2: 73,197,835 (GRCm39) Y456* probably null Het
Gpr156 T A 16: 37,812,523 (GRCm39) N286K probably damaging Het
Kcna5 A G 6: 126,511,808 (GRCm39) S107P probably benign Het
Kcne2 A T 16: 92,093,710 (GRCm39) H79L possibly damaging Het
Kcnh4 T A 11: 100,648,025 (GRCm39) M113L probably benign Het
Lad1 T A 1: 135,755,513 (GRCm39) L263Q probably damaging Het
Lctl G A 9: 64,034,249 (GRCm39) G296D probably damaging Het
Lmtk3 A T 7: 45,437,424 (GRCm39) I205F possibly damaging Het
Magel2 G T 7: 62,029,079 (GRCm39) R661L unknown Het
Mcm10 G A 2: 5,011,920 (GRCm39) P180S possibly damaging Het
Mia3 G T 1: 183,108,247 (GRCm39) A446D Het
N4bp2 G A 5: 65,963,714 (GRCm39) V588M probably benign Het
Naip6 C T 13: 100,436,259 (GRCm39) V755M probably benign Het
Neurl1a T C 19: 47,229,099 (GRCm39) V213A probably damaging Het
Nrdc A G 4: 108,896,946 (GRCm39) T522A probably damaging Het
Ntng1 T C 3: 110,042,763 (GRCm39) Q21R probably damaging Het
Nup160 T C 2: 90,534,296 (GRCm39) L707S probably damaging Het
Oas2 A T 5: 120,876,587 (GRCm39) V452D probably damaging Het
Or10a3n A G 7: 108,493,429 (GRCm39) F67L probably damaging Het
Or1j1 A G 2: 36,702,915 (GRCm39) L63P probably damaging Het
Or1j4 A T 2: 36,740,081 (GRCm39) M8L probably benign Het
Or52s1 A C 7: 102,861,516 (GRCm39) T150P probably damaging Het
Plekhg1 A T 10: 3,914,327 (GRCm39) T1405S Het
Pnrc1 G A 4: 33,248,300 (GRCm39) P33L probably damaging Het
Prkag2 A T 5: 25,085,684 (GRCm39) V312E possibly damaging Het
Rps17 T A 7: 80,994,093 (GRCm39) E76V possibly damaging Het
Rsph10b G A 5: 143,904,038 (GRCm39) G672S possibly damaging Het
Slc2a13 T C 15: 91,205,807 (GRCm39) N460S probably benign Het
Slco2b1 A T 7: 99,339,764 (GRCm39) C56S possibly damaging Het
Speer1f G A 5: 11,466,403 (GRCm39) D7N possibly damaging Het
Spn T C 7: 126,736,178 (GRCm39) T110A probably benign Het
Sult2a8 T C 7: 14,147,640 (GRCm39) N217S possibly damaging Het
Tbx2 C A 11: 85,724,315 (GRCm39) T128N probably damaging Het
Tecpr2 A T 12: 110,934,278 (GRCm39) M1313L probably benign Het
Tmc2 G A 2: 130,038,497 (GRCm39) probably null Het
Tstd1 G T 1: 171,247,523 (GRCm39) A69S probably damaging Het
Txnrd3 A G 6: 89,638,567 (GRCm39) D252G probably benign Het
Ulk2 T C 11: 61,710,174 (GRCm39) N345D probably damaging Het
Unc13c T C 9: 73,481,355 (GRCm39) D1694G probably benign Het
Vill T C 9: 118,894,561 (GRCm39) V406A probably damaging Het
Vmn2r115 T C 17: 23,564,887 (GRCm39) V258A possibly damaging Het
Vmn2r82 T A 10: 79,232,452 (GRCm39) M817K probably benign Het
Xpnpep3 T C 15: 81,315,088 (GRCm39) S263P probably benign Het
Zfp980 A G 4: 145,428,714 (GRCm39) D481G probably benign Het
Zmpste24 A G 4: 120,952,778 (GRCm39) S81P probably damaging Het
Znrf4 A G 17: 56,819,169 (GRCm39) V46A probably benign Het
Other mutations in Or1n1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Or1n1 APN 2 36,749,787 (GRCm39) missense probably benign 0.04
IGL02481:Or1n1 APN 2 36,749,830 (GRCm39) missense probably damaging 0.96
IGL02673:Or1n1 APN 2 36,750,188 (GRCm39) missense probably benign 0.25
IGL02754:Or1n1 APN 2 36,750,232 (GRCm39) missense probably damaging 1.00
P0041:Or1n1 UTSW 2 36,749,473 (GRCm39) missense probably damaging 1.00
R1392:Or1n1 UTSW 2 36,750,187 (GRCm39) missense probably damaging 1.00
R1392:Or1n1 UTSW 2 36,750,187 (GRCm39) missense probably damaging 1.00
R2271:Or1n1 UTSW 2 36,749,637 (GRCm39) missense probably damaging 1.00
R2274:Or1n1 UTSW 2 36,750,113 (GRCm39) missense probably damaging 0.99
R3053:Or1n1 UTSW 2 36,749,959 (GRCm39) missense probably benign 0.06
R4712:Or1n1 UTSW 2 36,750,381 (GRCm39) splice site probably null
R5001:Or1n1 UTSW 2 36,750,082 (GRCm39) missense probably benign 0.00
R5364:Or1n1 UTSW 2 36,750,006 (GRCm39) missense probably damaging 1.00
R5502:Or1n1 UTSW 2 36,750,282 (GRCm39) missense probably damaging 0.98
R6048:Or1n1 UTSW 2 36,749,853 (GRCm39) missense probably benign 0.00
R6401:Or1n1 UTSW 2 36,750,177 (GRCm39) nonsense probably null
R7798:Or1n1 UTSW 2 36,750,348 (GRCm39) missense probably benign 0.01
R7934:Or1n1 UTSW 2 36,750,228 (GRCm39) missense possibly damaging 0.73
R8725:Or1n1 UTSW 2 36,749,610 (GRCm39) missense probably damaging 1.00
R8842:Or1n1 UTSW 2 36,749,539 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGTTCAACATAGGAGTCACCAC -3'
(R):5'- ACATAGTTGCCCTGACTCACAC -3'

Sequencing Primer
(F):5'- CTGTATACATCGCAGCAGCTG -3'
(R):5'- ATGGCTCGACTGTCCTTCTGTG -3'
Posted On 2019-09-13