Incidental Mutation 'R7353:Arhgef2'
ID570717
Institutional Source Beutler Lab
Gene Symbol Arhgef2
Ensembl Gene ENSMUSG00000028059
Gene Namerho/rac guanine nucleotide exchange factor (GEF) 2
SynonymsP40, Lfc, Lbcl1, GEFH1, LFP40, GEF-H1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.681) question?
Stock #R7353 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location88605966-88648052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88635686 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 397 (V397E)
Ref Sequence ENSEMBL: ENSMUSP00000029694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029694] [ENSMUST00000107510] [ENSMUST00000170653] [ENSMUST00000175745] [ENSMUST00000175779] [ENSMUST00000175903] [ENSMUST00000175911] [ENSMUST00000176243] [ENSMUST00000176307] [ENSMUST00000176316] [ENSMUST00000176500] [ENSMUST00000176539] [ENSMUST00000176804] [ENSMUST00000176879] [ENSMUST00000177023] [ENSMUST00000177303] [ENSMUST00000177498]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029694
AA Change: V397E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029694
Gene: ENSMUSG00000028059
AA Change: V397E

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 240 432 1.86e-58 SMART
PH 474 574 9.56e-11 SMART
coiled coil region 588 619 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
coiled coil region 829 866 N/A INTRINSIC
low complexity region 872 888 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107510
AA Change: V370E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103134
Gene: ENSMUSG00000028059
AA Change: V370E

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 213 405 1.86e-58 SMART
PH 447 547 9.56e-11 SMART
coiled coil region 561 592 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
coiled coil region 802 839 N/A INTRINSIC
low complexity region 845 861 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170653
AA Change: V368E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127843
Gene: ENSMUSG00000028059
AA Change: V368E

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175745
SMART Domains Protein: ENSMUSP00000135044
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175779
AA Change: V382E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135177
Gene: ENSMUSG00000028059
AA Change: V382E

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175903
AA Change: V380E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135168
Gene: ENSMUSG00000028059
AA Change: V380E

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175911
AA Change: V389E

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135428
Gene: ENSMUSG00000028059
AA Change: V389E

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
low complexity region 125 138 N/A INTRINSIC
RhoGEF 232 424 1.86e-58 SMART
PH 466 566 9.56e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176243
SMART Domains Protein: ENSMUSP00000135771
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
Blast:RhoGEF 170 203 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176307
SMART Domains Protein: ENSMUSP00000134843
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176316
SMART Domains Protein: ENSMUSP00000135808
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176500
AA Change: V382E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134834
Gene: ENSMUSG00000028059
AA Change: V382E

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176539
SMART Domains Protein: ENSMUSP00000135612
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
Blast:RhoGEF 184 253 2e-28 BLAST
PDB:4D0N|B 196 255 1e-17 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000176804
AA Change: V395E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135397
Gene: ENSMUSG00000028059
AA Change: V395E

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 238 430 1.86e-58 SMART
PH 472 572 9.56e-11 SMART
coiled coil region 586 617 N/A INTRINSIC
low complexity region 810 825 N/A INTRINSIC
coiled coil region 827 864 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176879
SMART Domains Protein: ENSMUSP00000134766
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177023
SMART Domains Protein: ENSMUSP00000134859
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
Blast:RhoGEF 182 208 5e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177303
AA Change: V368E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135131
Gene: ENSMUSG00000028059
AA Change: V368E

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177498
AA Change: V380E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134840
Gene: ENSMUSG00000028059
AA Change: V380E

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate rho-dependent signals. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Arhgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Arhgef2 APN 3 88631919 missense probably damaging 1.00
IGL02165:Arhgef2 APN 3 88646220 missense probably damaging 1.00
monument UTSW 3 88633648 critical splice donor site probably null
R0090:Arhgef2 UTSW 3 88639348 missense probably damaging 1.00
R0330:Arhgef2 UTSW 3 88642501 missense probably damaging 1.00
R0414:Arhgef2 UTSW 3 88632268 splice site probably benign
R0631:Arhgef2 UTSW 3 88634436 missense probably damaging 0.99
R1635:Arhgef2 UTSW 3 88639321 critical splice acceptor site probably null
R1688:Arhgef2 UTSW 3 88640300 missense probably benign 0.32
R1751:Arhgef2 UTSW 3 88643953 missense probably damaging 1.00
R1767:Arhgef2 UTSW 3 88643953 missense probably damaging 1.00
R1836:Arhgef2 UTSW 3 88639459 missense probably damaging 1.00
R1853:Arhgef2 UTSW 3 88632915 missense possibly damaging 0.48
R1934:Arhgef2 UTSW 3 88629791 missense probably damaging 0.96
R2155:Arhgef2 UTSW 3 88636044 missense probably damaging 1.00
R2206:Arhgef2 UTSW 3 88629914 missense probably damaging 1.00
R2360:Arhgef2 UTSW 3 88634416 missense probably damaging 1.00
R3916:Arhgef2 UTSW 3 88633033 missense probably damaging 1.00
R4090:Arhgef2 UTSW 3 88643878 missense probably benign 0.01
R4732:Arhgef2 UTSW 3 88631940 nonsense probably null
R4733:Arhgef2 UTSW 3 88631940 nonsense probably null
R4837:Arhgef2 UTSW 3 88632943 missense probably damaging 1.00
R4952:Arhgef2 UTSW 3 88642462 missense probably damaging 1.00
R5152:Arhgef2 UTSW 3 88629568 splice site probably null
R5194:Arhgef2 UTSW 3 88635649 missense probably damaging 1.00
R5250:Arhgef2 UTSW 3 88633648 critical splice donor site probably null
R5334:Arhgef2 UTSW 3 88646329 missense probably damaging 0.96
R5514:Arhgef2 UTSW 3 88642997 missense probably benign 0.01
R5560:Arhgef2 UTSW 3 88634437 missense probably damaging 0.97
R5595:Arhgef2 UTSW 3 88642976 missense probably benign 0.00
R5879:Arhgef2 UTSW 3 88643617 splice site probably null
R5910:Arhgef2 UTSW 3 88635020 missense probably damaging 1.00
R5914:Arhgef2 UTSW 3 88635869 missense probably benign
R5918:Arhgef2 UTSW 3 88636080 missense probably damaging 1.00
R6181:Arhgef2 UTSW 3 88635620 missense probably damaging 1.00
R6489:Arhgef2 UTSW 3 88643014 missense probably damaging 1.00
R7167:Arhgef2 UTSW 3 88643872 missense possibly damaging 0.56
R7289:Arhgef2 UTSW 3 88635885 missense probably benign
R7318:Arhgef2 UTSW 3 88632303 missense probably damaging 0.98
R7402:Arhgef2 UTSW 3 88633566 missense probably damaging 1.00
R7441:Arhgef2 UTSW 3 88643955 missense probably damaging 0.96
R7899:Arhgef2 UTSW 3 88621262 missense probably damaging 1.00
R7934:Arhgef2 UTSW 3 88629914 missense probably damaging 1.00
R8002:Arhgef2 UTSW 3 88646810 missense probably damaging 1.00
R8254:Arhgef2 UTSW 3 88642603 missense probably damaging 1.00
R8297:Arhgef2 UTSW 3 88639432 missense probably benign 0.00
R8314:Arhgef2 UTSW 3 88621293 missense probably benign 0.00
R8350:Arhgef2 UTSW 3 88646220 missense probably damaging 1.00
R8450:Arhgef2 UTSW 3 88646220 missense probably damaging 1.00
R8755:Arhgef2 UTSW 3 88629543 missense probably benign 0.00
V1662:Arhgef2 UTSW 3 88633329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAGAAGCTGTGCCTAG -3'
(R):5'- TTCACTAGTCCTAGGGCTGAC -3'

Sequencing Primer
(F):5'- TGTGCCTAGGCCAACATG -3'
(R):5'- AAGTCTTGGTACTCTTCTTCAACC -3'
Posted On2019-09-13