Incidental Mutation 'R7353:Arhgef2'
ID 570717
Institutional Source Beutler Lab
Gene Symbol Arhgef2
Ensembl Gene ENSMUSG00000028059
Gene Name Rho/Rac guanine nucleotide exchange factor 2
Synonyms Lfc, Lbcl1, LFP40, P40, GEFH1, GEF-H1
MMRRC Submission 045439-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.664) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 88513273-88555359 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88542993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 397 (V397E)
Ref Sequence ENSEMBL: ENSMUSP00000029694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029694] [ENSMUST00000107510] [ENSMUST00000170653] [ENSMUST00000175745] [ENSMUST00000175779] [ENSMUST00000175903] [ENSMUST00000175911] [ENSMUST00000176243] [ENSMUST00000176307] [ENSMUST00000176316] [ENSMUST00000176500] [ENSMUST00000176539] [ENSMUST00000176804] [ENSMUST00000176879] [ENSMUST00000177023] [ENSMUST00000177303] [ENSMUST00000177498]
AlphaFold Q60875
Predicted Effect possibly damaging
Transcript: ENSMUST00000029694
AA Change: V397E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029694
Gene: ENSMUSG00000028059
AA Change: V397E

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 240 432 1.86e-58 SMART
PH 474 574 9.56e-11 SMART
coiled coil region 588 619 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
coiled coil region 829 866 N/A INTRINSIC
low complexity region 872 888 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107510
AA Change: V370E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103134
Gene: ENSMUSG00000028059
AA Change: V370E

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 213 405 1.86e-58 SMART
PH 447 547 9.56e-11 SMART
coiled coil region 561 592 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
coiled coil region 802 839 N/A INTRINSIC
low complexity region 845 861 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170653
AA Change: V368E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127843
Gene: ENSMUSG00000028059
AA Change: V368E

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175745
SMART Domains Protein: ENSMUSP00000135044
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175779
AA Change: V382E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135177
Gene: ENSMUSG00000028059
AA Change: V382E

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175903
AA Change: V380E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135168
Gene: ENSMUSG00000028059
AA Change: V380E

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175911
AA Change: V389E

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135428
Gene: ENSMUSG00000028059
AA Change: V389E

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
low complexity region 125 138 N/A INTRINSIC
RhoGEF 232 424 1.86e-58 SMART
PH 466 566 9.56e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176243
SMART Domains Protein: ENSMUSP00000135771
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
Blast:RhoGEF 170 203 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176307
SMART Domains Protein: ENSMUSP00000134843
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176316
SMART Domains Protein: ENSMUSP00000135808
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176500
AA Change: V382E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134834
Gene: ENSMUSG00000028059
AA Change: V382E

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176539
SMART Domains Protein: ENSMUSP00000135612
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
Blast:RhoGEF 184 253 2e-28 BLAST
PDB:4D0N|B 196 255 1e-17 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000176804
AA Change: V395E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135397
Gene: ENSMUSG00000028059
AA Change: V395E

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 238 430 1.86e-58 SMART
PH 472 572 9.56e-11 SMART
coiled coil region 586 617 N/A INTRINSIC
low complexity region 810 825 N/A INTRINSIC
coiled coil region 827 864 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176879
SMART Domains Protein: ENSMUSP00000134766
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177023
SMART Domains Protein: ENSMUSP00000134859
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
Blast:RhoGEF 182 208 5e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177303
AA Change: V368E

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135131
Gene: ENSMUSG00000028059
AA Change: V368E

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177498
AA Change: V380E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134840
Gene: ENSMUSG00000028059
AA Change: V380E

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate rho-dependent signals. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,624,714 (GRCm39) A11S unknown Het
Aadacl4 G A 4: 144,344,490 (GRCm39) V89I probably damaging Het
Abcc9 T A 6: 142,546,731 (GRCm39) I1369F probably damaging Het
Adgrf3 T A 5: 30,403,495 (GRCm39) I427F probably damaging Het
Alox12e T C 11: 70,212,261 (GRCm39) Y139C probably damaging Het
Arhgef28 T A 13: 98,211,710 (GRCm39) Y91F probably damaging Het
Bcar3 A G 3: 122,306,341 (GRCm39) T454A probably benign Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Boc C T 16: 44,306,100 (GRCm39) V1070M unknown Het
Ccdc88a T A 11: 29,413,368 (GRCm39) N635K probably benign Het
Ccr2 T C 9: 123,906,793 (GRCm39) S358P probably damaging Het
Ccser2 T C 14: 36,663,100 (GRCm39) Q28R possibly damaging Het
Cenpf T A 1: 189,386,335 (GRCm39) K1982* probably null Het
Csn1s2a A T 5: 87,933,161 (GRCm39) I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,943 (GRCm39) I1532K possibly damaging Het
Dnajc13 C A 9: 104,107,230 (GRCm39) R304L possibly damaging Het
Dop1a T A 9: 86,394,912 (GRCm39) M664K probably damaging Het
Emilin3 T A 2: 160,750,741 (GRCm39) E336V probably damaging Het
Eml5 A G 12: 98,791,683 (GRCm39) Y63H Het
Fbxo41 G T 6: 85,456,958 (GRCm39) R404S possibly damaging Het
Gpr155 A T 2: 73,197,835 (GRCm39) Y456* probably null Het
Gpr156 T A 16: 37,812,523 (GRCm39) N286K probably damaging Het
Kcna5 A G 6: 126,511,808 (GRCm39) S107P probably benign Het
Kcne2 A T 16: 92,093,710 (GRCm39) H79L possibly damaging Het
Kcnh4 T A 11: 100,648,025 (GRCm39) M113L probably benign Het
Lad1 T A 1: 135,755,513 (GRCm39) L263Q probably damaging Het
Lctl G A 9: 64,034,249 (GRCm39) G296D probably damaging Het
Lmtk3 A T 7: 45,437,424 (GRCm39) I205F possibly damaging Het
Magel2 G T 7: 62,029,079 (GRCm39) R661L unknown Het
Mcm10 G A 2: 5,011,920 (GRCm39) P180S possibly damaging Het
Mia3 G T 1: 183,108,247 (GRCm39) A446D Het
N4bp2 G A 5: 65,963,714 (GRCm39) V588M probably benign Het
Naip6 C T 13: 100,436,259 (GRCm39) V755M probably benign Het
Neurl1a T C 19: 47,229,099 (GRCm39) V213A probably damaging Het
Nrdc A G 4: 108,896,946 (GRCm39) T522A probably damaging Het
Ntng1 T C 3: 110,042,763 (GRCm39) Q21R probably damaging Het
Nup160 T C 2: 90,534,296 (GRCm39) L707S probably damaging Het
Oas2 A T 5: 120,876,587 (GRCm39) V452D probably damaging Het
Or10a3n A G 7: 108,493,429 (GRCm39) F67L probably damaging Het
Or1j1 A G 2: 36,702,915 (GRCm39) L63P probably damaging Het
Or1j4 A T 2: 36,740,081 (GRCm39) M8L probably benign Het
Or1n1 G A 2: 36,749,680 (GRCm39) R227* probably null Het
Or52s1 A C 7: 102,861,516 (GRCm39) T150P probably damaging Het
Plekhg1 A T 10: 3,914,327 (GRCm39) T1405S Het
Pnrc1 G A 4: 33,248,300 (GRCm39) P33L probably damaging Het
Prkag2 A T 5: 25,085,684 (GRCm39) V312E possibly damaging Het
Rps17 T A 7: 80,994,093 (GRCm39) E76V possibly damaging Het
Rsph10b G A 5: 143,904,038 (GRCm39) G672S possibly damaging Het
Slc2a13 T C 15: 91,205,807 (GRCm39) N460S probably benign Het
Slco2b1 A T 7: 99,339,764 (GRCm39) C56S possibly damaging Het
Speer1f G A 5: 11,466,403 (GRCm39) D7N possibly damaging Het
Spn T C 7: 126,736,178 (GRCm39) T110A probably benign Het
Sult2a8 T C 7: 14,147,640 (GRCm39) N217S possibly damaging Het
Tbx2 C A 11: 85,724,315 (GRCm39) T128N probably damaging Het
Tecpr2 A T 12: 110,934,278 (GRCm39) M1313L probably benign Het
Tmc2 G A 2: 130,038,497 (GRCm39) probably null Het
Tstd1 G T 1: 171,247,523 (GRCm39) A69S probably damaging Het
Txnrd3 A G 6: 89,638,567 (GRCm39) D252G probably benign Het
Ulk2 T C 11: 61,710,174 (GRCm39) N345D probably damaging Het
Unc13c T C 9: 73,481,355 (GRCm39) D1694G probably benign Het
Vill T C 9: 118,894,561 (GRCm39) V406A probably damaging Het
Vmn2r115 T C 17: 23,564,887 (GRCm39) V258A possibly damaging Het
Vmn2r82 T A 10: 79,232,452 (GRCm39) M817K probably benign Het
Xpnpep3 T C 15: 81,315,088 (GRCm39) S263P probably benign Het
Zfp980 A G 4: 145,428,714 (GRCm39) D481G probably benign Het
Zmpste24 A G 4: 120,952,778 (GRCm39) S81P probably damaging Het
Znrf4 A G 17: 56,819,169 (GRCm39) V46A probably benign Het
Other mutations in Arhgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Arhgef2 APN 3 88,539,226 (GRCm39) missense probably damaging 1.00
IGL02165:Arhgef2 APN 3 88,553,527 (GRCm39) missense probably damaging 1.00
monument UTSW 3 88,540,955 (GRCm39) critical splice donor site probably null
R0090:Arhgef2 UTSW 3 88,546,655 (GRCm39) missense probably damaging 1.00
R0330:Arhgef2 UTSW 3 88,549,808 (GRCm39) missense probably damaging 1.00
R0414:Arhgef2 UTSW 3 88,539,575 (GRCm39) splice site probably benign
R0631:Arhgef2 UTSW 3 88,541,743 (GRCm39) missense probably damaging 0.99
R1635:Arhgef2 UTSW 3 88,546,628 (GRCm39) critical splice acceptor site probably null
R1688:Arhgef2 UTSW 3 88,547,607 (GRCm39) missense probably benign 0.32
R1751:Arhgef2 UTSW 3 88,551,260 (GRCm39) missense probably damaging 1.00
R1767:Arhgef2 UTSW 3 88,551,260 (GRCm39) missense probably damaging 1.00
R1836:Arhgef2 UTSW 3 88,546,766 (GRCm39) missense probably damaging 1.00
R1853:Arhgef2 UTSW 3 88,540,222 (GRCm39) missense possibly damaging 0.48
R1934:Arhgef2 UTSW 3 88,537,098 (GRCm39) missense probably damaging 0.96
R2155:Arhgef2 UTSW 3 88,543,351 (GRCm39) missense probably damaging 1.00
R2206:Arhgef2 UTSW 3 88,537,221 (GRCm39) missense probably damaging 1.00
R2360:Arhgef2 UTSW 3 88,541,723 (GRCm39) missense probably damaging 1.00
R3916:Arhgef2 UTSW 3 88,540,340 (GRCm39) missense probably damaging 1.00
R4090:Arhgef2 UTSW 3 88,551,185 (GRCm39) missense probably benign 0.01
R4732:Arhgef2 UTSW 3 88,539,247 (GRCm39) nonsense probably null
R4733:Arhgef2 UTSW 3 88,539,247 (GRCm39) nonsense probably null
R4837:Arhgef2 UTSW 3 88,540,250 (GRCm39) missense probably damaging 1.00
R4952:Arhgef2 UTSW 3 88,549,769 (GRCm39) missense probably damaging 1.00
R5152:Arhgef2 UTSW 3 88,536,875 (GRCm39) splice site probably null
R5194:Arhgef2 UTSW 3 88,542,956 (GRCm39) missense probably damaging 1.00
R5250:Arhgef2 UTSW 3 88,540,955 (GRCm39) critical splice donor site probably null
R5334:Arhgef2 UTSW 3 88,553,636 (GRCm39) missense probably damaging 0.96
R5514:Arhgef2 UTSW 3 88,550,304 (GRCm39) missense probably benign 0.01
R5560:Arhgef2 UTSW 3 88,541,744 (GRCm39) missense probably damaging 0.97
R5595:Arhgef2 UTSW 3 88,550,283 (GRCm39) missense probably benign 0.00
R5879:Arhgef2 UTSW 3 88,550,924 (GRCm39) splice site probably null
R5910:Arhgef2 UTSW 3 88,542,327 (GRCm39) missense probably damaging 1.00
R5914:Arhgef2 UTSW 3 88,543,176 (GRCm39) missense probably benign
R5918:Arhgef2 UTSW 3 88,543,387 (GRCm39) missense probably damaging 1.00
R6181:Arhgef2 UTSW 3 88,542,927 (GRCm39) missense probably damaging 1.00
R6489:Arhgef2 UTSW 3 88,550,321 (GRCm39) missense probably damaging 1.00
R7167:Arhgef2 UTSW 3 88,551,179 (GRCm39) missense possibly damaging 0.56
R7289:Arhgef2 UTSW 3 88,543,192 (GRCm39) missense probably benign
R7318:Arhgef2 UTSW 3 88,539,610 (GRCm39) missense probably damaging 0.98
R7402:Arhgef2 UTSW 3 88,540,873 (GRCm39) missense probably damaging 1.00
R7441:Arhgef2 UTSW 3 88,551,262 (GRCm39) missense probably damaging 0.96
R7899:Arhgef2 UTSW 3 88,528,569 (GRCm39) missense probably damaging 1.00
R7934:Arhgef2 UTSW 3 88,537,221 (GRCm39) missense probably damaging 1.00
R8002:Arhgef2 UTSW 3 88,554,117 (GRCm39) missense probably damaging 1.00
R8254:Arhgef2 UTSW 3 88,549,910 (GRCm39) missense probably damaging 1.00
R8297:Arhgef2 UTSW 3 88,546,739 (GRCm39) missense probably benign 0.00
R8314:Arhgef2 UTSW 3 88,528,600 (GRCm39) missense probably benign 0.00
R8350:Arhgef2 UTSW 3 88,553,527 (GRCm39) missense probably damaging 1.00
R8450:Arhgef2 UTSW 3 88,553,527 (GRCm39) missense probably damaging 1.00
R8755:Arhgef2 UTSW 3 88,536,850 (GRCm39) missense probably benign 0.00
R9632:Arhgef2 UTSW 3 88,528,576 (GRCm39) missense probably benign 0.43
R9710:Arhgef2 UTSW 3 88,528,576 (GRCm39) missense probably benign 0.43
V1662:Arhgef2 UTSW 3 88,540,636 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAGAAGCTGTGCCTAG -3'
(R):5'- TTCACTAGTCCTAGGGCTGAC -3'

Sequencing Primer
(F):5'- TGTGCCTAGGCCAACATG -3'
(R):5'- AAGTCTTGGTACTCTTCTTCAACC -3'
Posted On 2019-09-13