Incidental Mutation 'R7353:Nrdc'
ID 570721
Institutional Source Beutler Lab
Gene Symbol Nrdc
Ensembl Gene ENSMUSG00000053510
Gene Name nardilysin convertase
Synonyms NRD-C, Nrd1
MMRRC Submission 045439-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.160) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 108857852-108918974 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108896946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 522 (T522A)
Ref Sequence ENSEMBL: ENSMUSP00000068328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065977] [ENSMUST00000102736] [ENSMUST00000106644] [ENSMUST00000125645]
AlphaFold Q8BHG1
Predicted Effect probably damaging
Transcript: ENSMUST00000065977
AA Change: T522A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510
AA Change: T522A

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.1e-43 PFAM
Pfam:Peptidase_M16_C 373 559 2.3e-22 PFAM
Pfam:Peptidase_M16_C 849 1032 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102736
AA Change: T478A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510
AA Change: T478A

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.4e-43 PFAM
Pfam:Peptidase_M16_C 400 515 1.1e-9 PFAM
Pfam:Peptidase_M16_C 805 988 2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106644
AA Change: T590A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102255
Gene: ENSMUSG00000053510
AA Change: T590A

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
coiled coil region 187 225 N/A INTRINSIC
Pfam:Peptidase_M16 281 416 1e-41 PFAM
Pfam:Peptidase_M16_C 441 627 2.2e-23 PFAM
Pfam:Peptidase_M16_M 631 913 1e-91 PFAM
Pfam:Peptidase_M16_C 917 1100 6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125645
AA Change: T274A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122808
Gene: ENSMUSG00000053510
AA Change: T274A

DomainStartEndE-ValueType
Pfam:Peptidase_M16 1 100 6.4e-27 PFAM
Pfam:Peptidase_M16_C 125 311 1.9e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent endopeptidase that cleaves peptide substrates at the N-terminus of arginine residues in dibasic moieties and is a member of the peptidase M16 family. This protein interacts with heparin-binding EGF-like growth factor and plays a role in cell migration and proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele mostly die within 48 hours of birth with surviving mice exhibiting cortical thinning, enlarged lateral ventricles, hypomyelination, reduced grip strength, impaired coordination, and impaired spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,624,714 (GRCm39) A11S unknown Het
Aadacl4 G A 4: 144,344,490 (GRCm39) V89I probably damaging Het
Abcc9 T A 6: 142,546,731 (GRCm39) I1369F probably damaging Het
Adgrf3 T A 5: 30,403,495 (GRCm39) I427F probably damaging Het
Alox12e T C 11: 70,212,261 (GRCm39) Y139C probably damaging Het
Arhgef2 T A 3: 88,542,993 (GRCm39) V397E possibly damaging Het
Arhgef28 T A 13: 98,211,710 (GRCm39) Y91F probably damaging Het
Bcar3 A G 3: 122,306,341 (GRCm39) T454A probably benign Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Boc C T 16: 44,306,100 (GRCm39) V1070M unknown Het
Ccdc88a T A 11: 29,413,368 (GRCm39) N635K probably benign Het
Ccr2 T C 9: 123,906,793 (GRCm39) S358P probably damaging Het
Ccser2 T C 14: 36,663,100 (GRCm39) Q28R possibly damaging Het
Cenpf T A 1: 189,386,335 (GRCm39) K1982* probably null Het
Csn1s2a A T 5: 87,933,161 (GRCm39) I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,943 (GRCm39) I1532K possibly damaging Het
Dnajc13 C A 9: 104,107,230 (GRCm39) R304L possibly damaging Het
Dop1a T A 9: 86,394,912 (GRCm39) M664K probably damaging Het
Emilin3 T A 2: 160,750,741 (GRCm39) E336V probably damaging Het
Eml5 A G 12: 98,791,683 (GRCm39) Y63H Het
Fbxo41 G T 6: 85,456,958 (GRCm39) R404S possibly damaging Het
Gpr155 A T 2: 73,197,835 (GRCm39) Y456* probably null Het
Gpr156 T A 16: 37,812,523 (GRCm39) N286K probably damaging Het
Kcna5 A G 6: 126,511,808 (GRCm39) S107P probably benign Het
Kcne2 A T 16: 92,093,710 (GRCm39) H79L possibly damaging Het
Kcnh4 T A 11: 100,648,025 (GRCm39) M113L probably benign Het
Lad1 T A 1: 135,755,513 (GRCm39) L263Q probably damaging Het
Lctl G A 9: 64,034,249 (GRCm39) G296D probably damaging Het
Lmtk3 A T 7: 45,437,424 (GRCm39) I205F possibly damaging Het
Magel2 G T 7: 62,029,079 (GRCm39) R661L unknown Het
Mcm10 G A 2: 5,011,920 (GRCm39) P180S possibly damaging Het
Mia3 G T 1: 183,108,247 (GRCm39) A446D Het
N4bp2 G A 5: 65,963,714 (GRCm39) V588M probably benign Het
Naip6 C T 13: 100,436,259 (GRCm39) V755M probably benign Het
Neurl1a T C 19: 47,229,099 (GRCm39) V213A probably damaging Het
Ntng1 T C 3: 110,042,763 (GRCm39) Q21R probably damaging Het
Nup160 T C 2: 90,534,296 (GRCm39) L707S probably damaging Het
Oas2 A T 5: 120,876,587 (GRCm39) V452D probably damaging Het
Or10a3n A G 7: 108,493,429 (GRCm39) F67L probably damaging Het
Or1j1 A G 2: 36,702,915 (GRCm39) L63P probably damaging Het
Or1j4 A T 2: 36,740,081 (GRCm39) M8L probably benign Het
Or1n1 G A 2: 36,749,680 (GRCm39) R227* probably null Het
Or52s1 A C 7: 102,861,516 (GRCm39) T150P probably damaging Het
Plekhg1 A T 10: 3,914,327 (GRCm39) T1405S Het
Pnrc1 G A 4: 33,248,300 (GRCm39) P33L probably damaging Het
Prkag2 A T 5: 25,085,684 (GRCm39) V312E possibly damaging Het
Rps17 T A 7: 80,994,093 (GRCm39) E76V possibly damaging Het
Rsph10b G A 5: 143,904,038 (GRCm39) G672S possibly damaging Het
Slc2a13 T C 15: 91,205,807 (GRCm39) N460S probably benign Het
Slco2b1 A T 7: 99,339,764 (GRCm39) C56S possibly damaging Het
Speer1f G A 5: 11,466,403 (GRCm39) D7N possibly damaging Het
Spn T C 7: 126,736,178 (GRCm39) T110A probably benign Het
Sult2a8 T C 7: 14,147,640 (GRCm39) N217S possibly damaging Het
Tbx2 C A 11: 85,724,315 (GRCm39) T128N probably damaging Het
Tecpr2 A T 12: 110,934,278 (GRCm39) M1313L probably benign Het
Tmc2 G A 2: 130,038,497 (GRCm39) probably null Het
Tstd1 G T 1: 171,247,523 (GRCm39) A69S probably damaging Het
Txnrd3 A G 6: 89,638,567 (GRCm39) D252G probably benign Het
Ulk2 T C 11: 61,710,174 (GRCm39) N345D probably damaging Het
Unc13c T C 9: 73,481,355 (GRCm39) D1694G probably benign Het
Vill T C 9: 118,894,561 (GRCm39) V406A probably damaging Het
Vmn2r115 T C 17: 23,564,887 (GRCm39) V258A possibly damaging Het
Vmn2r82 T A 10: 79,232,452 (GRCm39) M817K probably benign Het
Xpnpep3 T C 15: 81,315,088 (GRCm39) S263P probably benign Het
Zfp980 A G 4: 145,428,714 (GRCm39) D481G probably benign Het
Zmpste24 A G 4: 120,952,778 (GRCm39) S81P probably damaging Het
Znrf4 A G 17: 56,819,169 (GRCm39) V46A probably benign Het
Other mutations in Nrdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Nrdc APN 4 108,903,884 (GRCm39) unclassified probably benign
IGL00857:Nrdc APN 4 108,911,199 (GRCm39) missense probably damaging 1.00
IGL01417:Nrdc APN 4 108,858,027 (GRCm39) utr 5 prime probably benign
IGL01457:Nrdc APN 4 108,904,857 (GRCm39) missense probably benign 0.03
IGL02112:Nrdc APN 4 108,884,629 (GRCm39) splice site probably benign
IGL02279:Nrdc APN 4 108,881,391 (GRCm39) splice site probably benign
IGL02332:Nrdc APN 4 108,858,185 (GRCm39) missense probably damaging 0.99
IGL02890:Nrdc APN 4 108,911,116 (GRCm39) missense possibly damaging 0.55
IGL03179:Nrdc APN 4 108,903,888 (GRCm39) unclassified probably benign
PIT4354001:Nrdc UTSW 4 108,911,222 (GRCm39) critical splice donor site probably null
R0551:Nrdc UTSW 4 108,904,905 (GRCm39) missense probably damaging 1.00
R1468:Nrdc UTSW 4 108,873,865 (GRCm39) missense probably benign 0.01
R1468:Nrdc UTSW 4 108,873,865 (GRCm39) missense probably benign 0.01
R1990:Nrdc UTSW 4 108,896,972 (GRCm39) nonsense probably null
R4391:Nrdc UTSW 4 108,903,841 (GRCm39) missense probably damaging 1.00
R4994:Nrdc UTSW 4 108,903,809 (GRCm39) missense probably benign
R5164:Nrdc UTSW 4 108,896,914 (GRCm39) missense probably damaging 0.99
R5229:Nrdc UTSW 4 108,906,305 (GRCm39) missense probably damaging 1.00
R5387:Nrdc UTSW 4 108,896,959 (GRCm39) missense probably damaging 1.00
R5530:Nrdc UTSW 4 108,904,806 (GRCm39) missense probably damaging 0.96
R5672:Nrdc UTSW 4 108,895,242 (GRCm39) nonsense probably null
R5990:Nrdc UTSW 4 108,876,268 (GRCm39) missense probably damaging 1.00
R6018:Nrdc UTSW 4 108,870,944 (GRCm39) missense probably benign 0.01
R6106:Nrdc UTSW 4 108,901,782 (GRCm39) missense probably damaging 0.99
R6114:Nrdc UTSW 4 108,901,782 (GRCm39) missense probably damaging 0.99
R6140:Nrdc UTSW 4 108,906,308 (GRCm39) missense probably damaging 0.97
R6285:Nrdc UTSW 4 108,895,203 (GRCm39) missense probably damaging 0.99
R6824:Nrdc UTSW 4 108,900,622 (GRCm39) missense probably damaging 1.00
R7019:Nrdc UTSW 4 108,885,999 (GRCm39) missense probably benign 0.33
R7735:Nrdc UTSW 4 108,895,182 (GRCm39) missense probably damaging 1.00
R8261:Nrdc UTSW 4 108,873,876 (GRCm39) missense possibly damaging 0.67
R8340:Nrdc UTSW 4 108,858,351 (GRCm39) missense probably damaging 1.00
R8352:Nrdc UTSW 4 108,876,260 (GRCm39) missense probably damaging 0.98
R8368:Nrdc UTSW 4 108,870,895 (GRCm39) missense probably benign 0.02
R8452:Nrdc UTSW 4 108,876,260 (GRCm39) missense probably damaging 0.98
R9350:Nrdc UTSW 4 108,889,658 (GRCm39) missense possibly damaging 0.93
R9428:Nrdc UTSW 4 108,858,121 (GRCm39) missense probably damaging 0.99
R9516:Nrdc UTSW 4 108,901,863 (GRCm39) missense probably benign
R9526:Nrdc UTSW 4 108,915,833 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTTACATCAAAAGCTCAGGTTCC -3'
(R):5'- TTGGCAGCCTGAAGTCAGAG -3'

Sequencing Primer
(F):5'- CAAAAGCTCAGGTTCCAAAATTTTAC -3'
(R):5'- CAGCCTGAAGTCAGAGTTGTAC -3'
Posted On 2019-09-13