Incidental Mutation 'R7353:Zfp980'
ID 570724
Institutional Source Beutler Lab
Gene Symbol Zfp980
Ensembl Gene ENSMUSG00000058186
Gene Name zinc finger protein 980
Synonyms Gm13242
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock # R7353 (G1)
Quality Score 171.009
Status Not validated
Chromosome 4
Chromosomal Location 145670685-145704441 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145702144 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 481 (D481G)
Ref Sequence ENSEMBL: ENSMUSP00000101364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105738] [ENSMUST00000180014]
AlphaFold A2A9J5
Predicted Effect probably benign
Transcript: ENSMUST00000105738
AA Change: D481G

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101364
Gene: ENSMUSG00000058186
AA Change: D481G

DomainStartEndE-ValueType
KRAB 28 90 1.46e-16 SMART
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 251 273 1.84e-4 SMART
ZnF_C2H2 279 301 3.49e-5 SMART
ZnF_C2H2 307 329 1.95e-3 SMART
ZnF_C2H2 335 357 5.67e-5 SMART
ZnF_C2H2 363 385 1.98e-4 SMART
ZnF_C2H2 391 413 1.98e-4 SMART
ZnF_C2H2 419 441 2.4e-3 SMART
ZnF_C2H2 447 469 1.22e-4 SMART
ZnF_C2H2 475 497 5.67e-5 SMART
ZnF_C2H2 503 525 1.98e-4 SMART
ZnF_C2H2 531 553 6.88e-4 SMART
ZnF_C2H2 559 581 1.58e-3 SMART
ZnF_C2H2 587 609 1.22e-4 SMART
ZnF_C2H2 615 635 1.26e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180014
AA Change: D481G

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000137589
Gene: ENSMUSG00000058186
AA Change: D481G

DomainStartEndE-ValueType
KRAB 28 90 1.46e-16 SMART
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 251 273 1.84e-4 SMART
ZnF_C2H2 279 301 3.49e-5 SMART
ZnF_C2H2 307 329 1.95e-3 SMART
ZnF_C2H2 335 357 5.67e-5 SMART
ZnF_C2H2 363 385 1.98e-4 SMART
ZnF_C2H2 391 413 1.98e-4 SMART
ZnF_C2H2 419 441 2.4e-3 SMART
ZnF_C2H2 447 469 1.22e-4 SMART
ZnF_C2H2 475 497 5.67e-5 SMART
ZnF_C2H2 503 525 1.98e-4 SMART
ZnF_C2H2 531 553 6.88e-4 SMART
ZnF_C2H2 559 581 1.58e-3 SMART
ZnF_C2H2 587 609 1.22e-4 SMART
ZnF_C2H2 615 635 1.26e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Zfp980
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Zfp980 APN 4 145701991 missense probably benign 0.00
R0164:Zfp980 UTSW 4 145701997 missense probably benign
R0164:Zfp980 UTSW 4 145701997 missense probably benign
R1186:Zfp980 UTSW 4 145702083 missense probably benign
R1761:Zfp980 UTSW 4 145702042 missense probably damaging 1.00
R3726:Zfp980 UTSW 4 145702083 missense probably benign
R4049:Zfp980 UTSW 4 145702600 missense probably damaging 1.00
R4467:Zfp980 UTSW 4 145702083 missense probably benign
R4610:Zfp980 UTSW 4 145702083 missense probably benign
R4622:Zfp980 UTSW 4 145702057 missense probably damaging 1.00
R4873:Zfp980 UTSW 4 145702083 missense probably benign
R5008:Zfp980 UTSW 4 145702083 missense probably benign
R5027:Zfp980 UTSW 4 145702083 missense probably benign
R5497:Zfp980 UTSW 4 145701447 missense probably damaging 1.00
R5995:Zfp980 UTSW 4 145701909 nonsense probably null
R6125:Zfp980 UTSW 4 145702638 makesense probably null
R7675:Zfp980 UTSW 4 145701594 nonsense probably null
R7939:Zfp980 UTSW 4 145702012 missense probably damaging 1.00
R8833:Zfp980 UTSW 4 145701026 missense probably benign 0.00
R9122:Zfp980 UTSW 4 145702264 missense probably damaging 1.00
R9165:Zfp980 UTSW 4 145701454 missense possibly damaging 0.95
R9361:Zfp980 UTSW 4 145701429 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTCATGCAGGAGAGAAACCG -3'
(R):5'- CTCCTGCATGAATTCTATGATGAACT -3'

Sequencing Primer
(F):5'- GCTTTACTGACAAAGGCAGTC -3'
(R):5'- CTCTCAGAGAGCCTTTGTGAGTAAAG -3'
Posted On 2019-09-13