Incidental Mutation 'R7353:Oas2'
ID 570730
Institutional Source Beutler Lab
Gene Symbol Oas2
Ensembl Gene ENSMUSG00000032690
Gene Name 2'-5' oligoadenylate synthetase 2
Synonyms 2'-5' oligoadenylate synthetase-like 11, Oasl11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 120730333-120749853 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120738522 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 452 (V452D)
Ref Sequence ENSEMBL: ENSMUSP00000080209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053909] [ENSMUST00000081491]
AlphaFold E9Q9A9
Predicted Effect probably damaging
Transcript: ENSMUST00000053909
AA Change: V452D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060082
Gene: ENSMUSG00000032690
AA Change: V452D

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
Pfam:OAS1_C 190 378 5.6e-75 PFAM
Pfam:NTP_transf_2 412 516 4e-9 PFAM
Pfam:OAS1_C 533 724 3.2e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081491
AA Change: V452D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080209
Gene: ENSMUSG00000032690
AA Change: V452D

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
Pfam:OAS1_C 191 376 1.9e-77 PFAM
Pfam:NTP_transf_2 412 516 1.3e-10 PFAM
Pfam:OAS1_C 534 722 2.6e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146101
SMART Domains Protein: ENSMUSP00000122053
Gene: ENSMUSG00000032690

DomainStartEndE-ValueType
Pfam:OAS1_C 45 233 2.8e-88 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 2-5A synthetase family, essential proteins involved in the innate immune response to viral infection. The encoded protein is induced by interferons and uses adenosine triphosphate in 2'-specific nucleotidyl transfer reactions to synthesize 2',5'-oligoadenylates (2-5As). These molecules activate latent RNase L, which results in viral RNA degradation and the inhibition of viral replication. The three known members of this gene family are located in a cluster on chromosome 12. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: In nursing mothers, homozygous knockout (by a point mutation in a critical domain) results in a failure of the alveoli to expand and a failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Oas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Oas2 APN 5 120738363 missense probably damaging 1.00
IGL00784:Oas2 APN 5 120738363 missense probably damaging 1.00
IGL01388:Oas2 APN 5 120748592 missense probably damaging 1.00
IGL01643:Oas2 APN 5 120736187 splice site probably benign
IGL01660:Oas2 APN 5 120741223 missense probably benign 0.00
IGL02346:Oas2 APN 5 120736088 missense probably benign 0.30
IGL02403:Oas2 APN 5 120748750 missense possibly damaging 0.59
IGL03297:Oas2 APN 5 120735085 missense possibly damaging 0.91
R0149:Oas2 UTSW 5 120738401 missense probably damaging 0.99
R0344:Oas2 UTSW 5 120743087 missense probably damaging 1.00
R0361:Oas2 UTSW 5 120738401 missense probably damaging 0.99
R0387:Oas2 UTSW 5 120745672 splice site probably benign
R0465:Oas2 UTSW 5 120735055 missense probably damaging 0.99
R2100:Oas2 UTSW 5 120745675 critical splice donor site probably null
R2324:Oas2 UTSW 5 120743274 missense probably benign 0.43
R2496:Oas2 UTSW 5 120748617 missense probably benign 0.00
R4357:Oas2 UTSW 5 120738669 critical splice donor site probably null
R4466:Oas2 UTSW 5 120749602 missense probably damaging 0.99
R4472:Oas2 UTSW 5 120741155 missense possibly damaging 0.81
R4632:Oas2 UTSW 5 120733481 missense probably benign 0.34
R4714:Oas2 UTSW 5 120733472 missense probably damaging 1.00
R4824:Oas2 UTSW 5 120738346 missense probably benign 0.32
R4872:Oas2 UTSW 5 120738534 missense probably damaging 1.00
R5629:Oas2 UTSW 5 120738451 nonsense probably null
R6351:Oas2 UTSW 5 120748538 missense probably benign
R6463:Oas2 UTSW 5 120734981 missense probably null 1.00
R6488:Oas2 UTSW 5 120738363 missense probably damaging 1.00
R6787:Oas2 UTSW 5 120738798 missense possibly damaging 0.77
R6945:Oas2 UTSW 5 120736139 missense probably benign 0.00
R7459:Oas2 UTSW 5 120749710 missense unknown
R7634:Oas2 UTSW 5 120733228 missense probably benign 0.18
R7639:Oas2 UTSW 5 120745686 nonsense probably null
R7958:Oas2 UTSW 5 120748766 missense probably benign 0.00
R7968:Oas2 UTSW 5 120738372 missense probably benign 0.38
R8158:Oas2 UTSW 5 120749773 start codon destroyed probably null
R8915:Oas2 UTSW 5 120738384 missense possibly damaging 0.88
R9266:Oas2 UTSW 5 120749572 missense probably damaging 1.00
R9428:Oas2 UTSW 5 120749511 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATAGGCGGGAAGGACATC -3'
(R):5'- CTTGAATTCTGACACCAAAGTCC -3'

Sequencing Primer
(F):5'- CGAACTCGACACTTTCATTGAGAGTC -3'
(R):5'- TGAATTCTGACACCAAAGTCCTGAAG -3'
Posted On 2019-09-13