Incidental Mutation 'R7353:Rsph10b'
ID570731
Institutional Source Beutler Lab
Gene Symbol Rsph10b
Ensembl Gene ENSMUSG00000075569
Gene Nameradial spoke head 10 homolog B (Chlamydomonas)
SynonymsRsph10b2, 4930526H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R7353 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location143933035-143985719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143967220 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 672 (G672S)
Ref Sequence ENSEMBL: ENSMUSP00000132687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166847] [ENSMUST00000212711]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166847
AA Change: G672S

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132687
Gene: ENSMUSG00000075569
AA Change: G672S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
MORN 177 198 1.84e0 SMART
MORN 202 223 3.21e1 SMART
MORN 225 246 1.67e-6 SMART
MORN 249 270 1.85e1 SMART
MORN 282 303 2.71e-6 SMART
MORN 305 326 3.53e-5 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
coiled coil region 787 841 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212711
AA Change: G250S

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Rsph10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rsph10b APN 5 143937087 makesense probably null
K7894:Rsph10b UTSW 5 143944520 missense probably damaging 1.00
R0136:Rsph10b UTSW 5 143959821 missense probably benign 0.05
R0149:Rsph10b UTSW 5 143938909 unclassified probably benign
R0326:Rsph10b UTSW 5 143967128 missense probably damaging 1.00
R0558:Rsph10b UTSW 5 143949338 missense probably benign 0.02
R1185:Rsph10b UTSW 5 143966462 splice site probably benign
R1185:Rsph10b UTSW 5 143966462 splice site probably benign
R1712:Rsph10b UTSW 5 143937149 missense probably damaging 0.96
R1832:Rsph10b UTSW 5 143967179 missense possibly damaging 0.79
R1909:Rsph10b UTSW 5 143985491 missense probably benign 0.09
R2044:Rsph10b UTSW 5 143967250 splice site probably null
R2155:Rsph10b UTSW 5 143961256 missense probably benign 0.05
R2842:Rsph10b UTSW 5 143979892 missense possibly damaging 0.81
R3805:Rsph10b UTSW 5 143958388 critical splice donor site probably null
R4031:Rsph10b UTSW 5 143985668 splice site probably null
R4792:Rsph10b UTSW 5 143937317 missense probably damaging 1.00
R4866:Rsph10b UTSW 5 143948529 missense probably benign 0.28
R6090:Rsph10b UTSW 5 143977128 missense probably benign 0.00
R6252:Rsph10b UTSW 5 143937121 missense possibly damaging 0.70
R6255:Rsph10b UTSW 5 143959746 missense probably damaging 1.00
R6518:Rsph10b UTSW 5 143963873 missense probably damaging 1.00
R7085:Rsph10b UTSW 5 143949284 missense possibly damaging 0.82
R7206:Rsph10b UTSW 5 143961192 missense possibly damaging 0.86
R7337:Rsph10b UTSW 5 143961215 missense probably benign 0.11
R7567:Rsph10b UTSW 5 143949426 missense possibly damaging 0.78
R8022:Rsph10b UTSW 5 143967232 missense probably benign 0.00
R8109:Rsph10b UTSW 5 143985530 missense probably benign 0.00
R8275:Rsph10b UTSW 5 143966505 missense possibly damaging 0.50
Z1177:Rsph10b UTSW 5 143977134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGTGTAGCCCCTATACAGG -3'
(R):5'- CAGACCTATAAGCTGTCTCCTG -3'

Sequencing Primer
(F):5'- TAGCCCCTATACAGGACTAATAAATG -3'
(R):5'- AGACCTATAAGCTGTCTCCTGGTATC -3'
Posted On2019-09-13