Mutagenetix > Incidental Mutation

Incidental Mutation 'R7353:Fbxo41'

570733

Institutional Source

Beutler Lab

Gene Symbol

Fbxo41

Ensembl Gene

ENSMUSG00000047013

Gene Name

F-box protein 41

Synonyms

D6Ertd538e

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.371) question?

Stock #

R7353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85469574-85502994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 85479976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 404 (R404S)

Ref Sequence

ENSEMBL: ENSMUSP00000125671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546]

AlphaFold

Q6NS60

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159062
AA Change: R404S

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013
AA Change: R404S

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
Pfam:F-box	536	592	4.8e-5	PFAM
Pfam:F-box-like	554	593	9e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161078
AA Change: R404S

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013
AA Change: R404S

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
Pfam:F-box	536	592	4.8e-5	PFAM
Pfam:F-box-like	554	593	9e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161546
AA Change: R404S

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013
AA Change: R404S

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
low complexity region	519	540	N/A	INTRINSIC
Pfam:F-box-like	554	593	5.6e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one of the four subunits of the SCF ubiquitin protein ligase complex that plays a role in phosphorylation-dependent ubiquitination. F-box proteins are divided into three classes depending on the interaction substrate domain each contains in addition to the F-box motif: FBXW proteins contain WD-40 domains, FBXL proteins contain leucine-rich repeats, and FBXO proteins contain either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the FBXO class. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and premature death by 10 weeks, growth retardation, abnormal gait, dragging hindlimbs, ataxia, impaired balance, impaired coordination, tremors and abnormal neuronal migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110070M22Rik	C	A	13: 119,488,178	A11S	unknown	Het
Aadacl4	G	A	4: 144,617,920	V89I	probably damaging	Het
Abcc9	T	A	6: 142,601,005	I1369F	probably damaging	Het
Adgrf3	T	A	5: 30,198,497	I427F	probably damaging	Het
Alox12e	T	C	11: 70,321,435	Y139C	probably damaging	Het
Arhgef2	T	A	3: 88,635,686	V397E	possibly damaging	Het
Arhgef28	T	A	13: 98,075,202	Y91F	probably damaging	Het
Bcar3	A	G	3: 122,512,692	T454A	probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Boc	C	T	16: 44,485,737	V1070M	unknown	Het
Ccdc88a	T	A	11: 29,463,368	N635K	probably benign	Het
Ccr2	T	C	9: 124,106,756	S358P	probably damaging	Het
Ccser2	T	C	14: 36,941,143	Q28R	possibly damaging	Het
Cenpf	T	A	1: 189,654,138	K1982*	probably null	Het
Csn1s2a	A	T	5: 87,785,302	I137F	possibly damaging	Het
Cttnbp2	A	T	6: 18,375,944	I1532K	possibly damaging	Het
Dnajc13	C	A	9: 104,230,031	R304L	possibly damaging	Het
Dopey1	T	A	9: 86,512,859	M664K	probably damaging	Het
Emilin3	T	A	2: 160,908,821	E336V	probably damaging	Het
Eml5	A	G	12: 98,825,424	Y63H		Het
Gm8897	G	A	5: 11,416,436	D7N	possibly damaging	Het
Gpr155	A	T	2: 73,367,491	Y456*	probably null	Het
Gpr156	T	A	16: 37,992,161	N286K	probably damaging	Het
Kcna5	A	G	6: 126,534,845	S107P	probably benign	Het
Kcne2	A	T	16: 92,296,822	H79L	possibly damaging	Het
Kcnh4	T	A	11: 100,757,199	M113L	probably benign	Het
Lad1	T	A	1: 135,827,775	L263Q	probably damaging	Het
Lctl	G	A	9: 64,126,967	G296D	probably damaging	Het
Lmtk3	A	T	7: 45,788,000	I205F	possibly damaging	Het
Magel2	G	T	7: 62,379,331	R661L	unknown	Het
Mcm10	G	A	2: 5,007,109	P180S	possibly damaging	Het
Mia3	G	T	1: 183,327,392	A446D		Het
N4bp2	G	A	5: 65,806,371	V588M	probably benign	Het
Naip6	C	T	13: 100,299,751	V755M	probably benign	Het
Neurl1a	T	C	19: 47,240,660	V213A	probably damaging	Het
Nrd1	A	G	4: 109,039,749	T522A	probably damaging	Het
Ntng1	T	C	3: 110,135,447	Q21R	probably damaging	Het
Nup160	T	C	2: 90,703,952	L707S	probably damaging	Het
Oas2	A	T	5: 120,738,522	V452D	probably damaging	Het
Olfr3	A	G	2: 36,812,903	L63P	probably damaging	Het
Olfr350	A	T	2: 36,850,069	M8L	probably benign	Het
Olfr351	G	A	2: 36,859,668	R227*	probably null	Het
Olfr519	A	G	7: 108,894,222	F67L	probably damaging	Het
Olfr593	A	C	7: 103,212,309	T150P	probably damaging	Het
Plekhg1	A	T	10: 3,964,327	T1405S		Het
Pnrc1	G	A	4: 33,248,300	P33L	probably damaging	Het
Prkag2	A	T	5: 24,880,686	V312E	possibly damaging	Het
Rps17	T	A	7: 81,344,345	E76V	possibly damaging	Het
Rsph10b	G	A	5: 143,967,220	G672S	possibly damaging	Het
Slc2a13	T	C	15: 91,321,604	N460S	probably benign	Het
Slco2b1	A	T	7: 99,690,557	C56S	possibly damaging	Het
Spn	T	C	7: 127,137,006	T110A	probably benign	Het
Sult2a8	T	C	7: 14,413,715	N217S	possibly damaging	Het
Tbx2	C	A	11: 85,833,489	T128N	probably damaging	Het
Tecpr2	A	T	12: 110,967,844	M1313L	probably benign	Het
Tmc2	G	A	2: 130,196,577		probably null	Het
Tstd1	G	T	1: 171,419,955	A69S	probably damaging	Het
Txnrd3	A	G	6: 89,661,585	D252G	probably benign	Het
Ulk2	T	C	11: 61,819,348	N345D	probably damaging	Het
Unc13c	T	C	9: 73,574,073	D1694G	probably benign	Het
Vill	T	C	9: 119,065,493	V406A	probably damaging	Het
Vmn2r115	T	C	17: 23,345,913	V258A	possibly damaging	Het
Vmn2r82	T	A	10: 79,396,618	M817K	probably benign	Het
Xpnpep3	T	C	15: 81,430,887	S263P	probably benign	Het
Zfp980	A	G	4: 145,702,144	D481G	probably benign	Het
Zmpste24	A	G	4: 121,095,581	S81P	probably damaging	Het
Znrf4	A	G	17: 56,512,169	V46A	probably benign	Het

Other mutations in Fbxo41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Fbxo41	APN	6	85478102	splice site	probably null
IGL00919:Fbxo41	APN	6	85478570	missense	probably damaging	1.00
IGL01135:Fbxo41	APN	6	85477908	missense	probably benign	0.41
IGL02084:Fbxo41	APN	6	85480765	critical splice donor site	probably null
IGL02343:Fbxo41	APN	6	85478171	missense	possibly damaging	0.78
IGL03284:Fbxo41	APN	6	85479765	missense	probably damaging	1.00
R0116:Fbxo41	UTSW	6	85477908	missense	probably damaging	1.00
R0452:Fbxo41	UTSW	6	85478182	missense	probably damaging	1.00
R2064:Fbxo41	UTSW	6	85478471	nonsense	probably null
R2065:Fbxo41	UTSW	6	85478471	nonsense	probably null
R2067:Fbxo41	UTSW	6	85478471	nonsense	probably null
R3433:Fbxo41	UTSW	6	85477631	missense	probably damaging	1.00
R3522:Fbxo41	UTSW	6	85484181	missense	probably benign	0.00
R4086:Fbxo41	UTSW	6	85478546	missense	possibly damaging	0.93
R4520:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4521:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4522:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4523:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4524:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4867:Fbxo41	UTSW	6	85475194	missense	probably benign
R4970:Fbxo41	UTSW	6	85477924	missense	probably damaging	1.00
R5000:Fbxo41	UTSW	6	85483919	missense	probably damaging	0.98
R5112:Fbxo41	UTSW	6	85477924	missense	probably damaging	1.00
R5330:Fbxo41	UTSW	6	85479906	missense	probably benign
R5331:Fbxo41	UTSW	6	85479906	missense	probably benign
R5334:Fbxo41	UTSW	6	85478483	missense	probably damaging	1.00
R5595:Fbxo41	UTSW	6	85479901	missense	probably benign	0.00
R5632:Fbxo41	UTSW	6	85484504	missense	probably damaging	1.00
R5698:Fbxo41	UTSW	6	85477656	missense	possibly damaging	0.88
R5801:Fbxo41	UTSW	6	85484533	missense	probably damaging	0.97
R5854:Fbxo41	UTSW	6	85475094	missense	probably damaging	1.00
R6258:Fbxo41	UTSW	6	85478555	missense	probably damaging	1.00
R6260:Fbxo41	UTSW	6	85478555	missense	probably damaging	1.00
R6615:Fbxo41	UTSW	6	85478523	missense	possibly damaging	0.60
R7061:Fbxo41	UTSW	6	85475466	missense	probably benign	0.36
R7681:Fbxo41	UTSW	6	85478479	nonsense	probably null
R8077:Fbxo41	UTSW	6	85473229	missense	probably damaging	0.98
R8801:Fbxo41	UTSW	6	85484681	missense	probably damaging	1.00
X0024:Fbxo41	UTSW	6	85478470	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTGACTCAGTAGTTCGGGAG -3'
(R):5'- CCCATTAGAGGCTTGTCTCC -3'

Sequencing Primer
(F):5'- AGTAGTTCGGGAGCCCACATC -3'
(R):5'- AGAGGCTTGTCTCCTTCTGTGC -3'

Posted On

2019-09-13