Mutagenetix > Incidental Mutation

Incidental Mutation 'R7353:Txnrd3'

570734

Institutional Source

Beutler Lab

Gene Symbol

Txnrd3

Ensembl Gene

ENSMUSG00000000811

Gene Name

thioredoxin reductase 3

Synonyms

Tgr, TR2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.484) question?

Stock #

R7353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89643988-89675529 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89661585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 252 (D252G)

Ref Sequence

ENSEMBL: ENSMUSP00000000828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000828] [ENSMUST00000101171]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000000828
AA Change: D252G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000000828
Gene: ENSMUSG00000000811
AA Change: D252G

Domain	Start	End	E-Value	Type
low complexity region	17	34	N/A	INTRINSIC
Pfam:Glutaredoxin	40	102	9.2e-18	PFAM
Pfam:Pyr_redox_2	129	466	2.5e-66	PFAM
Pfam:FAD_binding_2	130	290	4.6e-9	PFAM
Pfam:Pyr_redox	309	386	9.6e-16	PFAM
Pfam:Pyr_redox_dim	486	599	2.7e-31	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000101171
AA Change: D252G

SMART Domains

Protein: ENSMUSP00000098730
Gene: ENSMUSG00000000811
AA Change: D252G

Domain	Start	End	E-Value	Type
low complexity region	17	34	N/A	INTRINSIC
Pfam:Glutaredoxin	40	102	1.5e-18	PFAM
Pfam:Thi4	116	222	3.9e-7	PFAM
Pfam:FAD_binding_2	130	264	3.7e-9	PFAM
Pfam:Pyr_redox_2	130	342	2.9e-24	PFAM
Pfam:Pyr_redox_dim	372	485	2.8e-31	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the family of pyridine nucleotide oxidoreductases. This protein catalyzes the reduction of thioredoxin, but unlike other mammalian thioredoxin reductases (TRs), it contains an additional glutaredoxin domain, and shows highest expression in testes. Like other TRs, it contains a C-terminal, penultimate selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for the use of a non-AUG (CUG) translation initiation site upstream of, and in-frame with the first AUG, leading to additional isoforms. [provided by RefSeq, May 2010]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110070M22Rik	C	A	13: 119,488,178	A11S	unknown	Het
Aadacl4	G	A	4: 144,617,920	V89I	probably damaging	Het
Abcc9	T	A	6: 142,601,005	I1369F	probably damaging	Het
Adgrf3	T	A	5: 30,198,497	I427F	probably damaging	Het
Alox12e	T	C	11: 70,321,435	Y139C	probably damaging	Het
Arhgef2	T	A	3: 88,635,686	V397E	possibly damaging	Het
Arhgef28	T	A	13: 98,075,202	Y91F	probably damaging	Het
Bcar3	A	G	3: 122,512,692	T454A	probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Boc	C	T	16: 44,485,737	V1070M	unknown	Het
Ccdc88a	T	A	11: 29,463,368	N635K	probably benign	Het
Ccr2	T	C	9: 124,106,756	S358P	probably damaging	Het
Ccser2	T	C	14: 36,941,143	Q28R	possibly damaging	Het
Cenpf	T	A	1: 189,654,138	K1982*	probably null	Het
Csn1s2a	A	T	5: 87,785,302	I137F	possibly damaging	Het
Cttnbp2	A	T	6: 18,375,944	I1532K	possibly damaging	Het
Dnajc13	C	A	9: 104,230,031	R304L	possibly damaging	Het
Dopey1	T	A	9: 86,512,859	M664K	probably damaging	Het
Emilin3	T	A	2: 160,908,821	E336V	probably damaging	Het
Eml5	A	G	12: 98,825,424	Y63H		Het
Fbxo41	G	T	6: 85,479,976	R404S	possibly damaging	Het
Gm8897	G	A	5: 11,416,436	D7N	possibly damaging	Het
Gpr155	A	T	2: 73,367,491	Y456*	probably null	Het
Gpr156	T	A	16: 37,992,161	N286K	probably damaging	Het
Kcna5	A	G	6: 126,534,845	S107P	probably benign	Het
Kcne2	A	T	16: 92,296,822	H79L	possibly damaging	Het
Kcnh4	T	A	11: 100,757,199	M113L	probably benign	Het
Lad1	T	A	1: 135,827,775	L263Q	probably damaging	Het
Lctl	G	A	9: 64,126,967	G296D	probably damaging	Het
Lmtk3	A	T	7: 45,788,000	I205F	possibly damaging	Het
Magel2	G	T	7: 62,379,331	R661L	unknown	Het
Mcm10	G	A	2: 5,007,109	P180S	possibly damaging	Het
Mia3	G	T	1: 183,327,392	A446D		Het
N4bp2	G	A	5: 65,806,371	V588M	probably benign	Het
Naip6	C	T	13: 100,299,751	V755M	probably benign	Het
Neurl1a	T	C	19: 47,240,660	V213A	probably damaging	Het
Nrd1	A	G	4: 109,039,749	T522A	probably damaging	Het
Ntng1	T	C	3: 110,135,447	Q21R	probably damaging	Het
Nup160	T	C	2: 90,703,952	L707S	probably damaging	Het
Oas2	A	T	5: 120,738,522	V452D	probably damaging	Het
Olfr3	A	G	2: 36,812,903	L63P	probably damaging	Het
Olfr350	A	T	2: 36,850,069	M8L	probably benign	Het
Olfr351	G	A	2: 36,859,668	R227*	probably null	Het
Olfr519	A	G	7: 108,894,222	F67L	probably damaging	Het
Olfr593	A	C	7: 103,212,309	T150P	probably damaging	Het
Plekhg1	A	T	10: 3,964,327	T1405S		Het
Pnrc1	G	A	4: 33,248,300	P33L	probably damaging	Het
Prkag2	A	T	5: 24,880,686	V312E	possibly damaging	Het
Rps17	T	A	7: 81,344,345	E76V	possibly damaging	Het
Rsph10b	G	A	5: 143,967,220	G672S	possibly damaging	Het
Slc2a13	T	C	15: 91,321,604	N460S	probably benign	Het
Slco2b1	A	T	7: 99,690,557	C56S	possibly damaging	Het
Spn	T	C	7: 127,137,006	T110A	probably benign	Het
Sult2a8	T	C	7: 14,413,715	N217S	possibly damaging	Het
Tbx2	C	A	11: 85,833,489	T128N	probably damaging	Het
Tecpr2	A	T	12: 110,967,844	M1313L	probably benign	Het
Tmc2	G	A	2: 130,196,577		probably null	Het
Tstd1	G	T	1: 171,419,955	A69S	probably damaging	Het
Ulk2	T	C	11: 61,819,348	N345D	probably damaging	Het
Unc13c	T	C	9: 73,574,073	D1694G	probably benign	Het
Vill	T	C	9: 119,065,493	V406A	probably damaging	Het
Vmn2r115	T	C	17: 23,345,913	V258A	possibly damaging	Het
Vmn2r82	T	A	10: 79,396,618	M817K	probably benign	Het
Xpnpep3	T	C	15: 81,430,887	S263P	probably benign	Het
Zfp980	A	G	4: 145,702,144	D481G	probably benign	Het
Zmpste24	A	G	4: 121,095,581	S81P	probably damaging	Het
Znrf4	A	G	17: 56,512,169	V46A	probably benign	Het

Other mutations in Txnrd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01449:Txnrd3	APN	6	89654147	missense	probably benign	0.15
IGL01763:Txnrd3	APN	6	89661555	missense	probably damaging	0.97
IGL02159:Txnrd3	APN	6	89669324	missense	probably damaging	1.00
IGL02238:Txnrd3	APN	6	89656135	missense	probably benign	0.02
IGL02452:Txnrd3	APN	6	89674795	makesense	probably null
R1054:Txnrd3	UTSW	6	89650561	nonsense	probably null
R3522:Txnrd3	UTSW	6	89663075	critical splice acceptor site	probably null
R5108:Txnrd3	UTSW	6	89673034	missense	probably benign	0.33
R5653:Txnrd3	UTSW	6	89654085	missense	probably benign	0.25
R6159:Txnrd3	UTSW	6	89663194	critical splice donor site	probably null
R6246:Txnrd3	UTSW	6	89651541	missense	probably benign	0.01
R6519:Txnrd3	UTSW	6	89654423	critical splice donor site	probably null
R6661:Txnrd3	UTSW	6	89654152	nonsense	probably null
R6685:Txnrd3	UTSW	6	89669915	missense	possibly damaging	0.84
R8987:Txnrd3	UTSW	6	89661495	missense	possibly damaging	0.78
R9014:Txnrd3	UTSW	6	89654109	missense	probably damaging	1.00
R9479:Txnrd3	UTSW	6	89663102	missense	possibly damaging	0.48
R9506:Txnrd3	UTSW	6	89661479	missense	possibly damaging	0.81
R9528:Txnrd3	UTSW	6	89672972	missense	probably damaging	0.99
R9574:Txnrd3	UTSW	6	89663184	nonsense	probably null
R9727:Txnrd3	UTSW	6	89674769	missense	probably benign	0.02
R9802:Txnrd3	UTSW	6	89663194	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTGGCTCATGTGATCAAACAATC -3'
(R):5'- ACCAGAGGTCTGAAAAGCAC -3'

Sequencing Primer
(F):5'- GGTGCACACATAATTCCTGGG -3'
(R):5'- CACACTTGAGGTCACATGCTGTAAG -3'

Posted On

2019-09-13