Incidental Mutation 'R7353:Kcna5'
ID 570735
Institutional Source Beutler Lab
Gene Symbol Kcna5
Ensembl Gene ENSMUSG00000045534
Gene Name potassium voltage-gated channel, shaker-related subfamily, member 5
Synonyms Kv1.5
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 126532551-126535412 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126534845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 107 (S107P)
Ref Sequence ENSEMBL: ENSMUSP00000055673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060972]
AlphaFold Q61762
Predicted Effect probably benign
Transcript: ENSMUST00000060972
AA Change: S107P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055673
Gene: ENSMUSG00000045534
AA Change: S107P

DomainStartEndE-ValueType
low complexity region 65 80 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
BTB 111 211 5e-7 SMART
Pfam:Ion_trans 240 516 6.6e-54 PFAM
Pfam:Ion_trans_2 424 509 1.4e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of familial atrial fibrillation type 7 (ATFB7). [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal microglial proliferation and nitric oxide release after LPS treatment or facial nerve lesion. Mice homozygous for a knock-in allele exhibit impaired hypoxic pulmonary vasoconstriction, and resistance to drug-induced cardiac QT prolongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Kcna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Kcna5 APN 6 126534509 missense probably damaging 1.00
H8562:Kcna5 UTSW 6 126533423 missense probably damaging 0.98
R0137:Kcna5 UTSW 6 126533383 missense probably damaging 1.00
R0881:Kcna5 UTSW 6 126534994 missense probably benign
R1436:Kcna5 UTSW 6 126534761 missense probably damaging 0.99
R1561:Kcna5 UTSW 6 126534583 missense probably damaging 1.00
R1730:Kcna5 UTSW 6 126533860 missense probably damaging 1.00
R1783:Kcna5 UTSW 6 126533860 missense probably damaging 1.00
R3940:Kcna5 UTSW 6 126533651 missense probably damaging 1.00
R4276:Kcna5 UTSW 6 126533366 missense probably damaging 1.00
R4372:Kcna5 UTSW 6 126533357 makesense probably null
R4562:Kcna5 UTSW 6 126534340 missense probably benign 0.00
R5130:Kcna5 UTSW 6 126534533 missense probably benign 0.01
R5137:Kcna5 UTSW 6 126533983 missense probably damaging 1.00
R5388:Kcna5 UTSW 6 126534896 missense probably benign 0.04
R5890:Kcna5 UTSW 6 126534736 missense probably damaging 1.00
R7159:Kcna5 UTSW 6 126533629 missense probably damaging 1.00
R7162:Kcna5 UTSW 6 126533843 missense possibly damaging 0.87
R7322:Kcna5 UTSW 6 126533791 missense possibly damaging 0.83
R7695:Kcna5 UTSW 6 126534211 missense probably damaging 1.00
R7775:Kcna5 UTSW 6 126534805 nonsense probably null
R7778:Kcna5 UTSW 6 126534805 nonsense probably null
R7894:Kcna5 UTSW 6 126535048 missense probably damaging 0.96
R7905:Kcna5 UTSW 6 126534868 missense probably benign
R7961:Kcna5 UTSW 6 126533554 missense probably benign
R8009:Kcna5 UTSW 6 126533554 missense probably benign
R8388:Kcna5 UTSW 6 126534625 missense probably benign 0.08
R9725:Kcna5 UTSW 6 126534881 missense probably benign
Z1176:Kcna5 UTSW 6 126533716 missense probably damaging 1.00
Z1177:Kcna5 UTSW 6 126533990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTGGTAGTAGTACAAAATGCC -3'
(R):5'- CGACGGCTGGACTCAATAATC -3'

Sequencing Primer
(F):5'- ATGCCATCGAAGCTAGGC -3'
(R):5'- GTCCAAAGAAACATCACCGAGGAG -3'
Posted On 2019-09-13