Incidental Mutation 'R7353:Rps17'
ID570740
Institutional Source Beutler Lab
Gene Symbol Rps17
Ensembl Gene ENSMUSG00000061787
Gene Nameribosomal protein S17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R7353 (G1)
Quality Score163.009
Status Not validated
Chromosome7
Chromosomal Location81342732-81345254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81344345 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 76 (E76V)
Ref Sequence ENSEMBL: ENSMUSP00000079628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080813] [ENSMUST00000098331] [ENSMUST00000130310] [ENSMUST00000178892]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080813
AA Change: E76V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079628
Gene: ENSMUSG00000061787
AA Change: E76V

DomainStartEndE-ValueType
Pfam:Ribosomal_S17e 1 119 9.7e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098331
SMART Domains Protein: ENSMUSP00000095936
Gene: ENSMUSG00000025586

DomainStartEndE-ValueType
low complexity region 112 126 N/A INTRINSIC
low complexity region 176 195 N/A INTRINSIC
RRM 311 386 2.6e-4 SMART
RRM_2 430 506 2.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130310
SMART Domains Protein: ENSMUSP00000120139
Gene: ENSMUSG00000025586

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 171 190 N/A INTRINSIC
RRM 306 376 1.35e-1 SMART
RRM 420 496 6.36e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178892
SMART Domains Protein: ENSMUSP00000137079
Gene: ENSMUSG00000025586

DomainStartEndE-ValueType
Pfam:CEBP1_N 1 307 2.5e-153 PFAM
RRM 312 387 6.25e-2 SMART
RRM 431 507 6.36e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S17E family of ribosomal proteins and is located in the cytoplasm. Mutations in this gene cause Diamond-Blackfan anemia 4. Alternative splicing of this gene results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Rps17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1340:Rps17 UTSW 7 81343733 critical splice donor site probably null
R2268:Rps17 UTSW 7 81344998 missense probably benign 0.00
R3710:Rps17 UTSW 7 81344924 missense probably benign 0.00
R8210:Rps17 UTSW 7 81345002 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAGGTCGGCTGATTACAGG -3'
(R):5'- GGGGTACATGACATTCGGAG -3'

Sequencing Primer
(F):5'- TGATTACAGGCACCCTCGG -3'
(R):5'- TGGACATCTGAACAGTGCTG -3'
Posted On2019-09-13