Incidental Mutation 'R7353:Slco2b1'
ID570741
Institutional Source Beutler Lab
Gene Symbol Slco2b1
Ensembl Gene ENSMUSG00000030737
Gene Namesolute carrier organic anion transporter family, member 2b1
SynonymsOATP-B, Slc21a9
MMRRC Submission
Accession Numbers

Genbank: NM_175316; MGI: 1351872

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7353 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location99657804-99711340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99690557 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 56 (C56S)
Ref Sequence ENSEMBL: ENSMUSP00000102703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032985] [ENSMUST00000107086] [ENSMUST00000107088] [ENSMUST00000137914] [ENSMUST00000145381] [ENSMUST00000207090] [ENSMUST00000208225]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032985
AA Change: C46S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032985
Gene: ENSMUSG00000030737
AA Change: C46S

DomainStartEndE-ValueType
Pfam:OATP 40 637 9.3e-189 PFAM
Pfam:MFS_1 44 468 1.9e-17 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107086
AA Change: C46S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102701
Gene: ENSMUSG00000030737
AA Change: C46S

DomainStartEndE-ValueType
Pfam:OATP 40 637 9.3e-189 PFAM
Pfam:MFS_1 44 468 1.9e-17 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107088
AA Change: C56S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102703
Gene: ENSMUSG00000030737
AA Change: C56S

DomainStartEndE-ValueType
Pfam:OATP 52 646 3.6e-182 PFAM
Pfam:MFS_1 53 476 2e-17 PFAM
transmembrane domain 650 672 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137914
AA Change: C60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115872
Gene: ENSMUSG00000030737
AA Change: C60S

DomainStartEndE-ValueType
Pfam:OATP 54 85 3.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145381
AA Change: C60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123439
Gene: ENSMUSG00000030737
AA Change: C60S

DomainStartEndE-ValueType
Pfam:OATP 54 150 6.5e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207090
AA Change: C60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208225
AA Change: C60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the organic anion-transporting polypeptide family of membrane proteins. The protein encoded by this locus may function in regulation of placental uptake of sulfated steroids. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Slco2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Slco2b1 APN 7 99660052 nonsense probably null
IGL00469:Slco2b1 APN 7 99660111 missense probably benign 0.21
IGL02625:Slco2b1 APN 7 99660123 splice site probably null
IGL03164:Slco2b1 APN 7 99685536 missense probably damaging 0.97
3-1:Slco2b1 UTSW 7 99685493 missense probably damaging 1.00
R0076:Slco2b1 UTSW 7 99685501 nonsense probably null
R0370:Slco2b1 UTSW 7 99690437 missense probably damaging 1.00
R0469:Slco2b1 UTSW 7 99661536 missense probably benign 0.30
R0510:Slco2b1 UTSW 7 99661536 missense probably benign 0.30
R1456:Slco2b1 UTSW 7 99664907 missense probably null
R1868:Slco2b1 UTSW 7 99686036 missense probably damaging 1.00
R2046:Slco2b1 UTSW 7 99690479 missense probably damaging 0.98
R4030:Slco2b1 UTSW 7 99682825 missense probably damaging 1.00
R4166:Slco2b1 UTSW 7 99660126 missense probably benign 0.30
R4406:Slco2b1 UTSW 7 99664889 missense probably benign 0.22
R4643:Slco2b1 UTSW 7 99667007 missense probably benign 0.00
R4770:Slco2b1 UTSW 7 99670949 critical splice donor site probably null
R4927:Slco2b1 UTSW 7 99685988 missense probably damaging 0.99
R5033:Slco2b1 UTSW 7 99660049 missense probably benign 0.14
R5166:Slco2b1 UTSW 7 99689013 missense possibly damaging 0.50
R5306:Slco2b1 UTSW 7 99688991 missense possibly damaging 0.79
R5358:Slco2b1 UTSW 7 99660044 missense unknown
R5389:Slco2b1 UTSW 7 99685925 missense probably damaging 0.98
R5874:Slco2b1 UTSW 7 99667094 missense probably benign
R6151:Slco2b1 UTSW 7 99690563 missense possibly damaging 0.46
R6163:Slco2b1 UTSW 7 99688899 missense probably damaging 1.00
R6192:Slco2b1 UTSW 7 99685572 missense probably damaging 1.00
R6489:Slco2b1 UTSW 7 99690555 nonsense probably null
R6651:Slco2b1 UTSW 7 99667169 missense probably benign 0.09
R7135:Slco2b1 UTSW 7 99695063 missense probably null 0.03
R7322:Slco2b1 UTSW 7 99691848 missense not run
R7474:Slco2b1 UTSW 7 99664832 missense probably damaging 1.00
R7888:Slco2b1 UTSW 7 99688843 missense unknown
R8121:Slco2b1 UTSW 7 99685553 missense probably benign 0.00
R8751:Slco2b1 UTSW 7 99660052 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCTCAGCACGCACTTCTG -3'
(R):5'- TGGGCTACTCCAATTAACTAACTC -3'

Sequencing Primer
(F):5'- CAAAGCGCTTTTCCACTG -3'
(R):5'- AACTAACTCTTTTCTTCTCTCCCTC -3'
Posted On2019-09-13