Incidental Mutation 'R7353:Slco2b1'
ID 570741
Institutional Source Beutler Lab
Gene Symbol Slco2b1
Ensembl Gene ENSMUSG00000030737
Gene Name solute carrier organic anion transporter family, member 2b1
Synonyms OATP-B, Slc21a9
MMRRC Submission 045439-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 99307011-99360547 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99339764 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 56 (C56S)
Ref Sequence ENSEMBL: ENSMUSP00000102703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032985] [ENSMUST00000107086] [ENSMUST00000107088] [ENSMUST00000137914] [ENSMUST00000145381] [ENSMUST00000207090] [ENSMUST00000208225]
AlphaFold Q8BXB6
Predicted Effect possibly damaging
Transcript: ENSMUST00000032985
AA Change: C46S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032985
Gene: ENSMUSG00000030737
AA Change: C46S

DomainStartEndE-ValueType
Pfam:OATP 40 637 9.3e-189 PFAM
Pfam:MFS_1 44 468 1.9e-17 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107086
AA Change: C46S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102701
Gene: ENSMUSG00000030737
AA Change: C46S

DomainStartEndE-ValueType
Pfam:OATP 40 637 9.3e-189 PFAM
Pfam:MFS_1 44 468 1.9e-17 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107088
AA Change: C56S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102703
Gene: ENSMUSG00000030737
AA Change: C56S

DomainStartEndE-ValueType
Pfam:OATP 52 646 3.6e-182 PFAM
Pfam:MFS_1 53 476 2e-17 PFAM
transmembrane domain 650 672 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137914
AA Change: C60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115872
Gene: ENSMUSG00000030737
AA Change: C60S

DomainStartEndE-ValueType
Pfam:OATP 54 85 3.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145381
AA Change: C60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123439
Gene: ENSMUSG00000030737
AA Change: C60S

DomainStartEndE-ValueType
Pfam:OATP 54 150 6.5e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207090
AA Change: C60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208225
AA Change: C60S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the organic anion-transporting polypeptide family of membrane proteins. The protein encoded by this locus may function in regulation of placental uptake of sulfated steroids. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,624,714 (GRCm39) A11S unknown Het
Aadacl4 G A 4: 144,344,490 (GRCm39) V89I probably damaging Het
Abcc9 T A 6: 142,546,731 (GRCm39) I1369F probably damaging Het
Adgrf3 T A 5: 30,403,495 (GRCm39) I427F probably damaging Het
Alox12e T C 11: 70,212,261 (GRCm39) Y139C probably damaging Het
Arhgef2 T A 3: 88,542,993 (GRCm39) V397E possibly damaging Het
Arhgef28 T A 13: 98,211,710 (GRCm39) Y91F probably damaging Het
Bcar3 A G 3: 122,306,341 (GRCm39) T454A probably benign Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Boc C T 16: 44,306,100 (GRCm39) V1070M unknown Het
Ccdc88a T A 11: 29,413,368 (GRCm39) N635K probably benign Het
Ccr2 T C 9: 123,906,793 (GRCm39) S358P probably damaging Het
Ccser2 T C 14: 36,663,100 (GRCm39) Q28R possibly damaging Het
Cenpf T A 1: 189,386,335 (GRCm39) K1982* probably null Het
Csn1s2a A T 5: 87,933,161 (GRCm39) I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,943 (GRCm39) I1532K possibly damaging Het
Dnajc13 C A 9: 104,107,230 (GRCm39) R304L possibly damaging Het
Dop1a T A 9: 86,394,912 (GRCm39) M664K probably damaging Het
Emilin3 T A 2: 160,750,741 (GRCm39) E336V probably damaging Het
Eml5 A G 12: 98,791,683 (GRCm39) Y63H Het
Fbxo41 G T 6: 85,456,958 (GRCm39) R404S possibly damaging Het
Gpr155 A T 2: 73,197,835 (GRCm39) Y456* probably null Het
Gpr156 T A 16: 37,812,523 (GRCm39) N286K probably damaging Het
Kcna5 A G 6: 126,511,808 (GRCm39) S107P probably benign Het
Kcne2 A T 16: 92,093,710 (GRCm39) H79L possibly damaging Het
Kcnh4 T A 11: 100,648,025 (GRCm39) M113L probably benign Het
Lad1 T A 1: 135,755,513 (GRCm39) L263Q probably damaging Het
Lctl G A 9: 64,034,249 (GRCm39) G296D probably damaging Het
Lmtk3 A T 7: 45,437,424 (GRCm39) I205F possibly damaging Het
Magel2 G T 7: 62,029,079 (GRCm39) R661L unknown Het
Mcm10 G A 2: 5,011,920 (GRCm39) P180S possibly damaging Het
Mia3 G T 1: 183,108,247 (GRCm39) A446D Het
N4bp2 G A 5: 65,963,714 (GRCm39) V588M probably benign Het
Naip6 C T 13: 100,436,259 (GRCm39) V755M probably benign Het
Neurl1a T C 19: 47,229,099 (GRCm39) V213A probably damaging Het
Nrdc A G 4: 108,896,946 (GRCm39) T522A probably damaging Het
Ntng1 T C 3: 110,042,763 (GRCm39) Q21R probably damaging Het
Nup160 T C 2: 90,534,296 (GRCm39) L707S probably damaging Het
Oas2 A T 5: 120,876,587 (GRCm39) V452D probably damaging Het
Or10a3n A G 7: 108,493,429 (GRCm39) F67L probably damaging Het
Or1j1 A G 2: 36,702,915 (GRCm39) L63P probably damaging Het
Or1j4 A T 2: 36,740,081 (GRCm39) M8L probably benign Het
Or1n1 G A 2: 36,749,680 (GRCm39) R227* probably null Het
Or52s1 A C 7: 102,861,516 (GRCm39) T150P probably damaging Het
Plekhg1 A T 10: 3,914,327 (GRCm39) T1405S Het
Pnrc1 G A 4: 33,248,300 (GRCm39) P33L probably damaging Het
Prkag2 A T 5: 25,085,684 (GRCm39) V312E possibly damaging Het
Rps17 T A 7: 80,994,093 (GRCm39) E76V possibly damaging Het
Rsph10b G A 5: 143,904,038 (GRCm39) G672S possibly damaging Het
Slc2a13 T C 15: 91,205,807 (GRCm39) N460S probably benign Het
Speer1f G A 5: 11,466,403 (GRCm39) D7N possibly damaging Het
Spn T C 7: 126,736,178 (GRCm39) T110A probably benign Het
Sult2a8 T C 7: 14,147,640 (GRCm39) N217S possibly damaging Het
Tbx2 C A 11: 85,724,315 (GRCm39) T128N probably damaging Het
Tecpr2 A T 12: 110,934,278 (GRCm39) M1313L probably benign Het
Tmc2 G A 2: 130,038,497 (GRCm39) probably null Het
Tstd1 G T 1: 171,247,523 (GRCm39) A69S probably damaging Het
Txnrd3 A G 6: 89,638,567 (GRCm39) D252G probably benign Het
Ulk2 T C 11: 61,710,174 (GRCm39) N345D probably damaging Het
Unc13c T C 9: 73,481,355 (GRCm39) D1694G probably benign Het
Vill T C 9: 118,894,561 (GRCm39) V406A probably damaging Het
Vmn2r115 T C 17: 23,564,887 (GRCm39) V258A possibly damaging Het
Vmn2r82 T A 10: 79,232,452 (GRCm39) M817K probably benign Het
Xpnpep3 T C 15: 81,315,088 (GRCm39) S263P probably benign Het
Zfp980 A G 4: 145,428,714 (GRCm39) D481G probably benign Het
Zmpste24 A G 4: 120,952,778 (GRCm39) S81P probably damaging Het
Znrf4 A G 17: 56,819,169 (GRCm39) V46A probably benign Het
Other mutations in Slco2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Slco2b1 APN 7 99,309,259 (GRCm39) nonsense probably null
IGL00469:Slco2b1 APN 7 99,309,318 (GRCm39) missense probably benign 0.21
IGL02625:Slco2b1 APN 7 99,309,330 (GRCm39) splice site probably null
IGL03164:Slco2b1 APN 7 99,334,743 (GRCm39) missense probably damaging 0.97
3-1:Slco2b1 UTSW 7 99,334,700 (GRCm39) missense probably damaging 1.00
R0076:Slco2b1 UTSW 7 99,334,708 (GRCm39) nonsense probably null
R0370:Slco2b1 UTSW 7 99,339,644 (GRCm39) missense probably damaging 1.00
R0469:Slco2b1 UTSW 7 99,310,743 (GRCm39) missense probably benign 0.30
R0510:Slco2b1 UTSW 7 99,310,743 (GRCm39) missense probably benign 0.30
R1456:Slco2b1 UTSW 7 99,314,114 (GRCm39) missense probably null
R1868:Slco2b1 UTSW 7 99,335,243 (GRCm39) missense probably damaging 1.00
R2046:Slco2b1 UTSW 7 99,339,686 (GRCm39) missense probably damaging 0.98
R4030:Slco2b1 UTSW 7 99,332,032 (GRCm39) missense probably damaging 1.00
R4166:Slco2b1 UTSW 7 99,309,333 (GRCm39) missense probably benign 0.30
R4406:Slco2b1 UTSW 7 99,314,096 (GRCm39) missense probably benign 0.22
R4643:Slco2b1 UTSW 7 99,316,214 (GRCm39) missense probably benign 0.00
R4770:Slco2b1 UTSW 7 99,320,156 (GRCm39) critical splice donor site probably null
R4927:Slco2b1 UTSW 7 99,335,195 (GRCm39) missense probably damaging 0.99
R5033:Slco2b1 UTSW 7 99,309,256 (GRCm39) missense probably benign 0.14
R5166:Slco2b1 UTSW 7 99,338,220 (GRCm39) missense possibly damaging 0.50
R5306:Slco2b1 UTSW 7 99,338,198 (GRCm39) missense possibly damaging 0.79
R5358:Slco2b1 UTSW 7 99,309,251 (GRCm39) missense unknown
R5389:Slco2b1 UTSW 7 99,335,132 (GRCm39) missense probably damaging 0.98
R5874:Slco2b1 UTSW 7 99,316,301 (GRCm39) missense probably benign
R6151:Slco2b1 UTSW 7 99,339,770 (GRCm39) missense possibly damaging 0.46
R6163:Slco2b1 UTSW 7 99,338,106 (GRCm39) missense probably damaging 1.00
R6192:Slco2b1 UTSW 7 99,334,779 (GRCm39) missense probably damaging 1.00
R6489:Slco2b1 UTSW 7 99,339,762 (GRCm39) nonsense probably null
R6651:Slco2b1 UTSW 7 99,316,376 (GRCm39) missense probably benign 0.09
R7135:Slco2b1 UTSW 7 99,344,270 (GRCm39) missense probably null 0.03
R7322:Slco2b1 UTSW 7 99,341,055 (GRCm39) missense not run
R7474:Slco2b1 UTSW 7 99,314,039 (GRCm39) missense probably damaging 1.00
R7888:Slco2b1 UTSW 7 99,338,050 (GRCm39) missense unknown
R8121:Slco2b1 UTSW 7 99,334,760 (GRCm39) missense probably benign 0.00
R8751:Slco2b1 UTSW 7 99,309,259 (GRCm39) nonsense probably null
R9031:Slco2b1 UTSW 7 99,338,214 (GRCm39) missense probably damaging 1.00
R9068:Slco2b1 UTSW 7 99,320,171 (GRCm39) missense probably benign 0.17
R9725:Slco2b1 UTSW 7 99,335,265 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCTCAGCACGCACTTCTG -3'
(R):5'- TGGGCTACTCCAATTAACTAACTC -3'

Sequencing Primer
(F):5'- CAAAGCGCTTTTCCACTG -3'
(R):5'- AACTAACTCTTTTCTTCTCTCCCTC -3'
Posted On 2019-09-13