Incidental Mutation 'R7353:Dopey1'
ID 570747
Institutional Source Beutler Lab
Gene Symbol Dopey1
Ensembl Gene ENSMUSG00000034973
Gene Name dopey family member 1
Synonyms B130005I07Rik, D9Ertd809e
MMRRC Submission
Accession Numbers

Genbank: NM_177208; MGI: 1289294
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 86467154-86555923 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86512859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 664 (M664K)
Ref Sequence ENSEMBL: ENSMUSP00000139413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000188675] [ENSMUST00000190957]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034987
AA Change: M673K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: M673K

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185919
AA Change: M671K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973
AA Change: M671K

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188675
AA Change: M664K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139413
Gene: ENSMUSG00000034973
AA Change: M664K

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 3e-106 PFAM
low complexity region 622 640 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190957
AA Change: M673K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: M673K

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Dopey1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dopey1 APN 9 86551679 missense possibly damaging 0.57
IGL00427:Dopey1 APN 9 86521500 missense probably benign 0.09
IGL00427:Dopey1 APN 9 86521498 missense possibly damaging 0.93
IGL00427:Dopey1 APN 9 86521499 missense probably damaging 0.96
IGL00577:Dopey1 APN 9 86520946 missense probably damaging 1.00
IGL00741:Dopey1 APN 9 86522806 missense possibly damaging 0.50
IGL00959:Dopey1 APN 9 86487431 missense probably damaging 1.00
IGL01339:Dopey1 APN 9 86551677 missense possibly damaging 0.90
IGL01608:Dopey1 APN 9 86507561 missense probably benign 0.23
IGL01760:Dopey1 APN 9 86519923 missense probably benign
IGL01788:Dopey1 APN 9 86531719 missense probably benign 0.03
IGL01844:Dopey1 APN 9 86514085 missense probably damaging 1.00
IGL01923:Dopey1 APN 9 86522867 missense probably damaging 1.00
IGL02036:Dopey1 APN 9 86531765 missense probably benign 0.18
IGL02308:Dopey1 APN 9 86520088 missense probably damaging 0.98
IGL02494:Dopey1 APN 9 86526818 missense probably damaging 1.00
IGL02698:Dopey1 APN 9 86524359 splice site probably benign
IGL02731:Dopey1 APN 9 86487381 missense probably damaging 1.00
IGL02821:Dopey1 APN 9 86520156 missense probably benign
IGL02952:Dopey1 APN 9 86532922 splice site probably benign
IGL03071:Dopey1 APN 9 86489615 missense possibly damaging 0.91
IGL03271:Dopey1 APN 9 86504222 nonsense probably null
IGL03344:Dopey1 APN 9 86536144 missense probably damaging 1.00
Beg UTSW 9 86548172 nonsense probably null
covet UTSW 9 86515343 missense probably damaging 1.00
crave UTSW 9 86517039 missense probably benign
desire UTSW 9 86520056 missense possibly damaging 0.47
groak UTSW 9 86521657 missense probably damaging 1.00
Querer UTSW 9 86504212 missense probably damaging 1.00
yearn UTSW 9 86504167 splice site probably null
R0055:Dopey1 UTSW 9 86512652 missense probably benign 0.08
R0285:Dopey1 UTSW 9 86512639 missense probably damaging 1.00
R0415:Dopey1 UTSW 9 86506502 missense probably damaging 1.00
R0427:Dopey1 UTSW 9 86507532 missense probably damaging 1.00
R0514:Dopey1 UTSW 9 86520734 missense probably damaging 1.00
R0538:Dopey1 UTSW 9 86485497 missense probably damaging 1.00
R1118:Dopey1 UTSW 9 86515406 missense probably damaging 1.00
R1158:Dopey1 UTSW 9 86485556 missense probably damaging 1.00
R1272:Dopey1 UTSW 9 86521424 missense probably damaging 1.00
R1448:Dopey1 UTSW 9 86542732 splice site probably null
R1584:Dopey1 UTSW 9 86548172 nonsense probably null
R1601:Dopey1 UTSW 9 86536250 missense probably damaging 0.99
R1674:Dopey1 UTSW 9 86536160 missense probably damaging 0.98
R1706:Dopey1 UTSW 9 86554080 missense possibly damaging 0.92
R1856:Dopey1 UTSW 9 86492004 missense probably damaging 0.99
R1926:Dopey1 UTSW 9 86523019 missense probably damaging 1.00
R1929:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2029:Dopey1 UTSW 9 86521365 missense probably damaging 1.00
R2125:Dopey1 UTSW 9 86521046 missense probably damaging 1.00
R2206:Dopey1 UTSW 9 86521599 missense probably benign 0.00
R2271:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2312:Dopey1 UTSW 9 86521442 nonsense probably null
R2379:Dopey1 UTSW 9 86521085 missense probably damaging 1.00
R2507:Dopey1 UTSW 9 86513117 missense probably damaging 1.00
R3737:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R3804:Dopey1 UTSW 9 86520995 missense probably damaging 1.00
R3916:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R3921:Dopey1 UTSW 9 86520271 missense probably benign 0.06
R4035:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R4392:Dopey1 UTSW 9 86503143 intron probably benign
R4404:Dopey1 UTSW 9 86522813 nonsense probably null
R4513:Dopey1 UTSW 9 86520559 missense probably benign 0.39
R4624:Dopey1 UTSW 9 86521525 missense probably damaging 1.00
R4659:Dopey1 UTSW 9 86502032 intron probably benign
R4910:Dopey1 UTSW 9 86492061 missense probably damaging 1.00
R4919:Dopey1 UTSW 9 86520056 missense possibly damaging 0.47
R5061:Dopey1 UTSW 9 86503108 splice site probably benign
R5079:Dopey1 UTSW 9 86487421 missense probably damaging 1.00
R5118:Dopey1 UTSW 9 86506259 missense probably damaging 1.00
R5169:Dopey1 UTSW 9 86533021 missense probably damaging 1.00
R5176:Dopey1 UTSW 9 86521815 missense probably damaging 1.00
R5190:Dopey1 UTSW 9 86487304 missense probably damaging 1.00
R5256:Dopey1 UTSW 9 86515328 missense probably damaging 1.00
R5346:Dopey1 UTSW 9 86520782 missense probably damaging 1.00
R5484:Dopey1 UTSW 9 86545288 missense probably damaging 1.00
R5501:Dopey1 UTSW 9 86507730 missense probably benign 0.04
R5554:Dopey1 UTSW 9 86521657 missense probably damaging 1.00
R5707:Dopey1 UTSW 9 86502997 missense possibly damaging 0.95
R5826:Dopey1 UTSW 9 86507570 missense possibly damaging 0.94
R5921:Dopey1 UTSW 9 86501922 missense probably damaging 1.00
R5934:Dopey1 UTSW 9 86542442 nonsense probably null
R5936:Dopey1 UTSW 9 86536512 nonsense probably null
R6046:Dopey1 UTSW 9 86515343 missense probably damaging 1.00
R6053:Dopey1 UTSW 9 86515294 missense possibly damaging 0.95
R6072:Dopey1 UTSW 9 86507697 missense probably benign 0.00
R6104:Dopey1 UTSW 9 86520807 missense possibly damaging 0.86
R6125:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R6299:Dopey1 UTSW 9 86504212 missense probably damaging 1.00
R6930:Dopey1 UTSW 9 86531772 critical splice donor site probably null
R6949:Dopey1 UTSW 9 86500860 missense probably damaging 1.00
R6979:Dopey1 UTSW 9 86521642 missense possibly damaging 0.77
R7035:Dopey1 UTSW 9 86524302 missense possibly damaging 0.85
R7069:Dopey1 UTSW 9 86550169 critical splice donor site probably null
R7101:Dopey1 UTSW 9 86507669 missense probably benign
R7202:Dopey1 UTSW 9 86504167 splice site probably null
R7222:Dopey1 UTSW 9 86522876 critical splice donor site probably null
R7233:Dopey1 UTSW 9 86521696 missense probably benign 0.00
R7236:Dopey1 UTSW 9 86515378 missense probably damaging 1.00
R7252:Dopey1 UTSW 9 86500821 missense probably damaging 1.00
R7268:Dopey1 UTSW 9 86512777 nonsense probably null
R7481:Dopey1 UTSW 9 86535932 missense probably damaging 1.00
R7498:Dopey1 UTSW 9 86494411 missense possibly damaging 0.95
R7507:Dopey1 UTSW 9 86535949 missense probably benign 0.01
R7525:Dopey1 UTSW 9 86506290 missense probably damaging 1.00
R7539:Dopey1 UTSW 9 86521573 missense probably benign 0.03
R7751:Dopey1 UTSW 9 86507730 missense probably benign 0.00
R7753:Dopey1 UTSW 9 86489702 missense possibly damaging 0.52
R7839:Dopey1 UTSW 9 86542765 nonsense probably null
R7868:Dopey1 UTSW 9 86501984 critical splice donor site probably null
R8061:Dopey1 UTSW 9 86521193 missense possibly damaging 0.95
R8067:Dopey1 UTSW 9 86518339 missense probably benign 0.00
R8156:Dopey1 UTSW 9 86494457 missense probably damaging 1.00
R8196:Dopey1 UTSW 9 86523098 missense probably benign 0.12
R8223:Dopey1 UTSW 9 86518292 missense probably damaging 1.00
R8267:Dopey1 UTSW 9 86514001 missense possibly damaging 0.81
R8276:Dopey1 UTSW 9 86517039 missense probably benign
R8306:Dopey1 UTSW 9 86520206 missense possibly damaging 0.94
R8353:Dopey1 UTSW 9 86521586 missense probably damaging 0.97
R8362:Dopey1 UTSW 9 86513888 missense probably benign 0.02
R8403:Dopey1 UTSW 9 86500872 missense probably damaging 1.00
R8817:Dopey1 UTSW 9 86513950 missense possibly damaging 0.91
R8862:Dopey1 UTSW 9 86524351 critical splice donor site probably null
R8888:Dopey1 UTSW 9 86521534 missense probably benign
R8972:Dopey1 UTSW 9 86521247 missense possibly damaging 0.50
R9001:Dopey1 UTSW 9 86554321 makesense probably null
R9011:Dopey1 UTSW 9 86515343 missense probably damaging 1.00
R9021:Dopey1 UTSW 9 86520437 missense probably benign 0.35
R9039:Dopey1 UTSW 9 86500817 missense probably damaging 0.99
R9128:Dopey1 UTSW 9 86513155 missense probably benign
R9178:Dopey1 UTSW 9 86489743 nonsense probably null
R9238:Dopey1 UTSW 9 86532974 missense probably benign
R9313:Dopey1 UTSW 9 86524588 makesense probably null
R9334:Dopey1 UTSW 9 86520974 missense probably damaging 1.00
R9422:Dopey1 UTSW 9 86543040 missense probably damaging 1.00
R9562:Dopey1 UTSW 9 86542758 missense probably damaging 1.00
R9584:Dopey1 UTSW 9 86503098 missense possibly damaging 0.59
R9677:Dopey1 UTSW 9 86543045 missense
RF004:Dopey1 UTSW 9 86554191 missense probably benign
X0019:Dopey1 UTSW 9 86506227 missense probably damaging 1.00
X0019:Dopey1 UTSW 9 86531750 missense probably damaging 0.98
ZE80:Dopey1 UTSW 9 86500842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTATCAAGCAGACCGG -3'
(R):5'- ACTGGGAAACTTGAGCACTC -3'

Sequencing Primer
(F):5'- TATCAAGCAGACCGGCCTGAC -3'
(R):5'- GAAGGCAGAAAGGTATTCTTTTGATG -3'
Posted On 2019-09-13