Incidental Mutation 'R7353:Dop1a'
ID 570747
Institutional Source Beutler Lab
Gene Symbol Dop1a
Ensembl Gene ENSMUSG00000034973
Gene Name DOP1 leucine zipper like protein A
Synonyms D9Ertd809e, B130005I07Rik, Dopey1
MMRRC Submission 045439-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.338) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 86349194-86436683 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86394912 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 664 (M664K)
Ref Sequence ENSEMBL: ENSMUSP00000139413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000188675] [ENSMUST00000190957]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034987
AA Change: M673K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: M673K

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185919
AA Change: M671K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973
AA Change: M671K

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188675
AA Change: M664K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139413
Gene: ENSMUSG00000034973
AA Change: M664K

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 3e-106 PFAM
low complexity region 622 640 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190957
AA Change: M673K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: M673K

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,624,714 (GRCm39) A11S unknown Het
Aadacl4 G A 4: 144,344,490 (GRCm39) V89I probably damaging Het
Abcc9 T A 6: 142,546,731 (GRCm39) I1369F probably damaging Het
Adgrf3 T A 5: 30,403,495 (GRCm39) I427F probably damaging Het
Alox12e T C 11: 70,212,261 (GRCm39) Y139C probably damaging Het
Arhgef2 T A 3: 88,542,993 (GRCm39) V397E possibly damaging Het
Arhgef28 T A 13: 98,211,710 (GRCm39) Y91F probably damaging Het
Bcar3 A G 3: 122,306,341 (GRCm39) T454A probably benign Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Boc C T 16: 44,306,100 (GRCm39) V1070M unknown Het
Ccdc88a T A 11: 29,413,368 (GRCm39) N635K probably benign Het
Ccr2 T C 9: 123,906,793 (GRCm39) S358P probably damaging Het
Ccser2 T C 14: 36,663,100 (GRCm39) Q28R possibly damaging Het
Cenpf T A 1: 189,386,335 (GRCm39) K1982* probably null Het
Csn1s2a A T 5: 87,933,161 (GRCm39) I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,943 (GRCm39) I1532K possibly damaging Het
Dnajc13 C A 9: 104,107,230 (GRCm39) R304L possibly damaging Het
Emilin3 T A 2: 160,750,741 (GRCm39) E336V probably damaging Het
Eml5 A G 12: 98,791,683 (GRCm39) Y63H Het
Fbxo41 G T 6: 85,456,958 (GRCm39) R404S possibly damaging Het
Gpr155 A T 2: 73,197,835 (GRCm39) Y456* probably null Het
Gpr156 T A 16: 37,812,523 (GRCm39) N286K probably damaging Het
Kcna5 A G 6: 126,511,808 (GRCm39) S107P probably benign Het
Kcne2 A T 16: 92,093,710 (GRCm39) H79L possibly damaging Het
Kcnh4 T A 11: 100,648,025 (GRCm39) M113L probably benign Het
Lad1 T A 1: 135,755,513 (GRCm39) L263Q probably damaging Het
Lctl G A 9: 64,034,249 (GRCm39) G296D probably damaging Het
Lmtk3 A T 7: 45,437,424 (GRCm39) I205F possibly damaging Het
Magel2 G T 7: 62,029,079 (GRCm39) R661L unknown Het
Mcm10 G A 2: 5,011,920 (GRCm39) P180S possibly damaging Het
Mia3 G T 1: 183,108,247 (GRCm39) A446D Het
N4bp2 G A 5: 65,963,714 (GRCm39) V588M probably benign Het
Naip6 C T 13: 100,436,259 (GRCm39) V755M probably benign Het
Neurl1a T C 19: 47,229,099 (GRCm39) V213A probably damaging Het
Nrdc A G 4: 108,896,946 (GRCm39) T522A probably damaging Het
Ntng1 T C 3: 110,042,763 (GRCm39) Q21R probably damaging Het
Nup160 T C 2: 90,534,296 (GRCm39) L707S probably damaging Het
Oas2 A T 5: 120,876,587 (GRCm39) V452D probably damaging Het
Or10a3n A G 7: 108,493,429 (GRCm39) F67L probably damaging Het
Or1j1 A G 2: 36,702,915 (GRCm39) L63P probably damaging Het
Or1j4 A T 2: 36,740,081 (GRCm39) M8L probably benign Het
Or1n1 G A 2: 36,749,680 (GRCm39) R227* probably null Het
Or52s1 A C 7: 102,861,516 (GRCm39) T150P probably damaging Het
Plekhg1 A T 10: 3,914,327 (GRCm39) T1405S Het
Pnrc1 G A 4: 33,248,300 (GRCm39) P33L probably damaging Het
Prkag2 A T 5: 25,085,684 (GRCm39) V312E possibly damaging Het
Rps17 T A 7: 80,994,093 (GRCm39) E76V possibly damaging Het
Rsph10b G A 5: 143,904,038 (GRCm39) G672S possibly damaging Het
Slc2a13 T C 15: 91,205,807 (GRCm39) N460S probably benign Het
Slco2b1 A T 7: 99,339,764 (GRCm39) C56S possibly damaging Het
Speer1f G A 5: 11,466,403 (GRCm39) D7N possibly damaging Het
Spn T C 7: 126,736,178 (GRCm39) T110A probably benign Het
Sult2a8 T C 7: 14,147,640 (GRCm39) N217S possibly damaging Het
Tbx2 C A 11: 85,724,315 (GRCm39) T128N probably damaging Het
Tecpr2 A T 12: 110,934,278 (GRCm39) M1313L probably benign Het
Tmc2 G A 2: 130,038,497 (GRCm39) probably null Het
Tstd1 G T 1: 171,247,523 (GRCm39) A69S probably damaging Het
Txnrd3 A G 6: 89,638,567 (GRCm39) D252G probably benign Het
Ulk2 T C 11: 61,710,174 (GRCm39) N345D probably damaging Het
Unc13c T C 9: 73,481,355 (GRCm39) D1694G probably benign Het
Vill T C 9: 118,894,561 (GRCm39) V406A probably damaging Het
Vmn2r115 T C 17: 23,564,887 (GRCm39) V258A possibly damaging Het
Vmn2r82 T A 10: 79,232,452 (GRCm39) M817K probably benign Het
Xpnpep3 T C 15: 81,315,088 (GRCm39) S263P probably benign Het
Zfp980 A G 4: 145,428,714 (GRCm39) D481G probably benign Het
Zmpste24 A G 4: 120,952,778 (GRCm39) S81P probably damaging Het
Znrf4 A G 17: 56,819,169 (GRCm39) V46A probably benign Het
Other mutations in Dop1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dop1a APN 9 86,433,732 (GRCm39) missense possibly damaging 0.57
IGL00427:Dop1a APN 9 86,403,552 (GRCm39) missense probably damaging 0.96
IGL00427:Dop1a APN 9 86,403,551 (GRCm39) missense possibly damaging 0.93
IGL00427:Dop1a APN 9 86,403,553 (GRCm39) missense probably benign 0.09
IGL00577:Dop1a APN 9 86,402,999 (GRCm39) missense probably damaging 1.00
IGL00741:Dop1a APN 9 86,404,859 (GRCm39) missense possibly damaging 0.50
IGL00959:Dop1a APN 9 86,369,484 (GRCm39) missense probably damaging 1.00
IGL01339:Dop1a APN 9 86,433,730 (GRCm39) missense possibly damaging 0.90
IGL01608:Dop1a APN 9 86,389,614 (GRCm39) missense probably benign 0.23
IGL01760:Dop1a APN 9 86,401,976 (GRCm39) missense probably benign
IGL01788:Dop1a APN 9 86,413,772 (GRCm39) missense probably benign 0.03
IGL01844:Dop1a APN 9 86,396,138 (GRCm39) missense probably damaging 1.00
IGL01923:Dop1a APN 9 86,404,920 (GRCm39) missense probably damaging 1.00
IGL02036:Dop1a APN 9 86,413,818 (GRCm39) missense probably benign 0.18
IGL02308:Dop1a APN 9 86,402,141 (GRCm39) missense probably damaging 0.98
IGL02494:Dop1a APN 9 86,408,871 (GRCm39) missense probably damaging 1.00
IGL02698:Dop1a APN 9 86,406,412 (GRCm39) splice site probably benign
IGL02731:Dop1a APN 9 86,369,434 (GRCm39) missense probably damaging 1.00
IGL02821:Dop1a APN 9 86,402,209 (GRCm39) missense probably benign
IGL02952:Dop1a APN 9 86,414,975 (GRCm39) splice site probably benign
IGL03071:Dop1a APN 9 86,371,668 (GRCm39) missense possibly damaging 0.91
IGL03271:Dop1a APN 9 86,386,275 (GRCm39) nonsense probably null
IGL03344:Dop1a APN 9 86,418,197 (GRCm39) missense probably damaging 1.00
Beg UTSW 9 86,430,225 (GRCm39) nonsense probably null
covet UTSW 9 86,397,396 (GRCm39) missense probably damaging 1.00
crave UTSW 9 86,399,092 (GRCm39) missense probably benign
desire UTSW 9 86,402,109 (GRCm39) missense possibly damaging 0.47
groak UTSW 9 86,403,710 (GRCm39) missense probably damaging 1.00
Querer UTSW 9 86,386,265 (GRCm39) missense probably damaging 1.00
yearn UTSW 9 86,386,220 (GRCm39) splice site probably null
R0055:Dop1a UTSW 9 86,394,705 (GRCm39) missense probably benign 0.08
R0285:Dop1a UTSW 9 86,394,692 (GRCm39) missense probably damaging 1.00
R0415:Dop1a UTSW 9 86,388,555 (GRCm39) missense probably damaging 1.00
R0427:Dop1a UTSW 9 86,389,585 (GRCm39) missense probably damaging 1.00
R0514:Dop1a UTSW 9 86,402,787 (GRCm39) missense probably damaging 1.00
R0538:Dop1a UTSW 9 86,367,550 (GRCm39) missense probably damaging 1.00
R1118:Dop1a UTSW 9 86,397,459 (GRCm39) missense probably damaging 1.00
R1158:Dop1a UTSW 9 86,367,609 (GRCm39) missense probably damaging 1.00
R1272:Dop1a UTSW 9 86,403,477 (GRCm39) missense probably damaging 1.00
R1448:Dop1a UTSW 9 86,424,785 (GRCm39) splice site probably null
R1584:Dop1a UTSW 9 86,430,225 (GRCm39) nonsense probably null
R1601:Dop1a UTSW 9 86,418,303 (GRCm39) missense probably damaging 0.99
R1674:Dop1a UTSW 9 86,418,213 (GRCm39) missense probably damaging 0.98
R1706:Dop1a UTSW 9 86,436,133 (GRCm39) missense possibly damaging 0.92
R1856:Dop1a UTSW 9 86,374,057 (GRCm39) missense probably damaging 0.99
R1926:Dop1a UTSW 9 86,405,072 (GRCm39) missense probably damaging 1.00
R1929:Dop1a UTSW 9 86,376,471 (GRCm39) missense probably damaging 1.00
R2029:Dop1a UTSW 9 86,403,418 (GRCm39) missense probably damaging 1.00
R2125:Dop1a UTSW 9 86,403,099 (GRCm39) missense probably damaging 1.00
R2206:Dop1a UTSW 9 86,403,652 (GRCm39) missense probably benign 0.00
R2271:Dop1a UTSW 9 86,376,471 (GRCm39) missense probably damaging 1.00
R2312:Dop1a UTSW 9 86,403,495 (GRCm39) nonsense probably null
R2379:Dop1a UTSW 9 86,403,138 (GRCm39) missense probably damaging 1.00
R2507:Dop1a UTSW 9 86,395,170 (GRCm39) missense probably damaging 1.00
R3737:Dop1a UTSW 9 86,376,486 (GRCm39) missense probably damaging 1.00
R3804:Dop1a UTSW 9 86,403,048 (GRCm39) missense probably damaging 1.00
R3916:Dop1a UTSW 9 86,403,186 (GRCm39) missense probably damaging 1.00
R3921:Dop1a UTSW 9 86,402,324 (GRCm39) missense probably benign 0.06
R4035:Dop1a UTSW 9 86,376,486 (GRCm39) missense probably damaging 1.00
R4392:Dop1a UTSW 9 86,385,196 (GRCm39) intron probably benign
R4404:Dop1a UTSW 9 86,404,866 (GRCm39) nonsense probably null
R4513:Dop1a UTSW 9 86,402,612 (GRCm39) missense probably benign 0.39
R4624:Dop1a UTSW 9 86,403,578 (GRCm39) missense probably damaging 1.00
R4659:Dop1a UTSW 9 86,384,085 (GRCm39) intron probably benign
R4910:Dop1a UTSW 9 86,374,114 (GRCm39) missense probably damaging 1.00
R4919:Dop1a UTSW 9 86,402,109 (GRCm39) missense possibly damaging 0.47
R5061:Dop1a UTSW 9 86,385,161 (GRCm39) splice site probably benign
R5079:Dop1a UTSW 9 86,369,474 (GRCm39) missense probably damaging 1.00
R5118:Dop1a UTSW 9 86,388,312 (GRCm39) missense probably damaging 1.00
R5169:Dop1a UTSW 9 86,415,074 (GRCm39) missense probably damaging 1.00
R5176:Dop1a UTSW 9 86,403,868 (GRCm39) missense probably damaging 1.00
R5190:Dop1a UTSW 9 86,369,357 (GRCm39) missense probably damaging 1.00
R5256:Dop1a UTSW 9 86,397,381 (GRCm39) missense probably damaging 1.00
R5346:Dop1a UTSW 9 86,402,835 (GRCm39) missense probably damaging 1.00
R5484:Dop1a UTSW 9 86,427,341 (GRCm39) missense probably damaging 1.00
R5501:Dop1a UTSW 9 86,389,783 (GRCm39) missense probably benign 0.04
R5554:Dop1a UTSW 9 86,403,710 (GRCm39) missense probably damaging 1.00
R5707:Dop1a UTSW 9 86,385,050 (GRCm39) missense possibly damaging 0.95
R5826:Dop1a UTSW 9 86,389,623 (GRCm39) missense possibly damaging 0.94
R5921:Dop1a UTSW 9 86,383,975 (GRCm39) missense probably damaging 1.00
R5934:Dop1a UTSW 9 86,424,495 (GRCm39) nonsense probably null
R5936:Dop1a UTSW 9 86,418,565 (GRCm39) nonsense probably null
R6046:Dop1a UTSW 9 86,397,396 (GRCm39) missense probably damaging 1.00
R6053:Dop1a UTSW 9 86,397,347 (GRCm39) missense possibly damaging 0.95
R6072:Dop1a UTSW 9 86,389,750 (GRCm39) missense probably benign 0.00
R6104:Dop1a UTSW 9 86,402,860 (GRCm39) missense possibly damaging 0.86
R6125:Dop1a UTSW 9 86,403,186 (GRCm39) missense probably damaging 1.00
R6299:Dop1a UTSW 9 86,386,265 (GRCm39) missense probably damaging 1.00
R6930:Dop1a UTSW 9 86,413,825 (GRCm39) critical splice donor site probably null
R6949:Dop1a UTSW 9 86,382,913 (GRCm39) missense probably damaging 1.00
R6979:Dop1a UTSW 9 86,403,695 (GRCm39) missense possibly damaging 0.77
R7035:Dop1a UTSW 9 86,406,355 (GRCm39) missense possibly damaging 0.85
R7069:Dop1a UTSW 9 86,432,222 (GRCm39) critical splice donor site probably null
R7101:Dop1a UTSW 9 86,389,722 (GRCm39) missense probably benign
R7202:Dop1a UTSW 9 86,386,220 (GRCm39) splice site probably null
R7222:Dop1a UTSW 9 86,404,929 (GRCm39) critical splice donor site probably null
R7233:Dop1a UTSW 9 86,403,749 (GRCm39) missense probably benign 0.00
R7236:Dop1a UTSW 9 86,397,431 (GRCm39) missense probably damaging 1.00
R7252:Dop1a UTSW 9 86,382,874 (GRCm39) missense probably damaging 1.00
R7268:Dop1a UTSW 9 86,394,830 (GRCm39) nonsense probably null
R7481:Dop1a UTSW 9 86,417,985 (GRCm39) missense probably damaging 1.00
R7498:Dop1a UTSW 9 86,376,464 (GRCm39) missense possibly damaging 0.95
R7507:Dop1a UTSW 9 86,418,002 (GRCm39) missense probably benign 0.01
R7525:Dop1a UTSW 9 86,388,343 (GRCm39) missense probably damaging 1.00
R7539:Dop1a UTSW 9 86,403,626 (GRCm39) missense probably benign 0.03
R7751:Dop1a UTSW 9 86,389,783 (GRCm39) missense probably benign 0.00
R7753:Dop1a UTSW 9 86,371,755 (GRCm39) missense possibly damaging 0.52
R7839:Dop1a UTSW 9 86,424,818 (GRCm39) nonsense probably null
R7868:Dop1a UTSW 9 86,384,037 (GRCm39) critical splice donor site probably null
R8061:Dop1a UTSW 9 86,403,246 (GRCm39) missense possibly damaging 0.95
R8067:Dop1a UTSW 9 86,400,392 (GRCm39) missense probably benign 0.00
R8156:Dop1a UTSW 9 86,376,510 (GRCm39) missense probably damaging 1.00
R8196:Dop1a UTSW 9 86,405,151 (GRCm39) missense probably benign 0.12
R8223:Dop1a UTSW 9 86,400,345 (GRCm39) missense probably damaging 1.00
R8267:Dop1a UTSW 9 86,396,054 (GRCm39) missense possibly damaging 0.81
R8276:Dop1a UTSW 9 86,399,092 (GRCm39) missense probably benign
R8306:Dop1a UTSW 9 86,402,259 (GRCm39) missense possibly damaging 0.94
R8353:Dop1a UTSW 9 86,403,639 (GRCm39) missense probably damaging 0.97
R8362:Dop1a UTSW 9 86,395,941 (GRCm39) missense probably benign 0.02
R8403:Dop1a UTSW 9 86,382,925 (GRCm39) missense probably damaging 1.00
R8817:Dop1a UTSW 9 86,396,003 (GRCm39) missense possibly damaging 0.91
R8862:Dop1a UTSW 9 86,406,404 (GRCm39) critical splice donor site probably null
R8888:Dop1a UTSW 9 86,403,587 (GRCm39) missense probably benign
R8972:Dop1a UTSW 9 86,403,300 (GRCm39) missense possibly damaging 0.50
R9001:Dop1a UTSW 9 86,436,374 (GRCm39) makesense probably null
R9011:Dop1a UTSW 9 86,397,396 (GRCm39) missense probably damaging 1.00
R9021:Dop1a UTSW 9 86,402,490 (GRCm39) missense probably benign 0.35
R9039:Dop1a UTSW 9 86,382,870 (GRCm39) missense probably damaging 0.99
R9128:Dop1a UTSW 9 86,395,208 (GRCm39) missense probably benign
R9178:Dop1a UTSW 9 86,371,796 (GRCm39) nonsense probably null
R9238:Dop1a UTSW 9 86,415,027 (GRCm39) missense probably benign
R9313:Dop1a UTSW 9 86,406,641 (GRCm39) makesense probably null
R9334:Dop1a UTSW 9 86,403,027 (GRCm39) missense probably damaging 1.00
R9422:Dop1a UTSW 9 86,425,093 (GRCm39) missense probably damaging 1.00
R9562:Dop1a UTSW 9 86,424,811 (GRCm39) missense probably damaging 1.00
R9584:Dop1a UTSW 9 86,385,151 (GRCm39) missense possibly damaging 0.59
R9677:Dop1a UTSW 9 86,425,098 (GRCm39) missense
RF004:Dop1a UTSW 9 86,436,244 (GRCm39) missense probably benign
X0019:Dop1a UTSW 9 86,413,803 (GRCm39) missense probably damaging 0.98
X0019:Dop1a UTSW 9 86,388,280 (GRCm39) missense probably damaging 1.00
ZE80:Dop1a UTSW 9 86,382,895 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTATCAAGCAGACCGG -3'
(R):5'- ACTGGGAAACTTGAGCACTC -3'

Sequencing Primer
(F):5'- TATCAAGCAGACCGGCCTGAC -3'
(R):5'- GAAGGCAGAAAGGTATTCTTTTGATG -3'
Posted On 2019-09-13