Incidental Mutation 'R7353:Ccr2'
ID570750
Institutional Source Beutler Lab
Gene Symbol Ccr2
Ensembl Gene ENSMUSG00000049103
Gene Namechemokine (C-C motif) receptor 2
SynonymsCmkbr2, CKR2A, CC-CKR-2, CKR2B, CCR2B, CKR2, CCR2A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7353 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location124101950-124113557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124106756 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 358 (S358P)
Ref Sequence ENSEMBL: ENSMUSP00000049909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055918] [ENSMUST00000165984] [ENSMUST00000168841] [ENSMUST00000171719]
Predicted Effect probably damaging
Transcript: ENSMUST00000055918
AA Change: S358P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049909
Gene: ENSMUSG00000049103
AA Change: S358P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 66 332 4.8e-8 PFAM
Pfam:7tm_1 72 318 1.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165984
AA Change: S358P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128734
Gene: ENSMUSG00000049103
AA Change: S358P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 66 332 4.8e-8 PFAM
Pfam:7tm_1 72 318 2.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168841
AA Change: S358P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132453
Gene: ENSMUSG00000049103
AA Change: S358P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 66 332 4.8e-8 PFAM
Pfam:7tm_1 72 318 2.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171719
AA Change: S358P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130112
Gene: ENSMUSG00000049103
AA Change: S358P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 66 332 4.8e-8 PFAM
Pfam:7tm_1 72 318 2.9e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two isoforms of a receptor for monocyte chemoattractant protein-1, a chemokine which specifically mediates monocyte chemotaxis. Monocyte chemoattractant protein-1 is involved in monocyte infiltration in inflammatory diseases such as rheumatoid arthritis as well as in the inflammatory response against tumors. The receptors encoded by this gene mediate agonist-dependent calcium mobilization and inhibition of adenylyl cyclase. This gene is located in the chemokine receptor gene cluster region. Two alternatively spliced transcript variants are expressed by the gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in leukocyte physiology that result in altered response to myocardial infarction and increased susceptibility to bacterial infection and colitis. Mice may also exhibit retinal degeneration and alcohol aversion depending on the knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Ccr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01816:Ccr2 APN 9 124106198 missense probably benign
IGL02678:Ccr2 APN 9 124106746 missense probably benign 0.00
IGL02962:Ccr2 APN 9 124105675 splice site probably benign
IGL03330:Ccr2 APN 9 124105959 missense probably damaging 1.00
IGL03381:Ccr2 APN 9 124106372 missense probably benign 0.22
R0499:Ccr2 UTSW 9 124105939 missense possibly damaging 0.55
R0499:Ccr2 UTSW 9 124106126 missense possibly damaging 0.77
R0602:Ccr2 UTSW 9 124106621 missense probably benign 0.02
R0714:Ccr2 UTSW 9 124105929 missense probably benign
R1975:Ccr2 UTSW 9 124106793 missense probably benign 0.05
R4785:Ccr2 UTSW 9 124106372 missense probably benign 0.22
R5858:Ccr2 UTSW 9 124106427 missense probably benign 0.45
R5901:Ccr2 UTSW 9 124106202 missense possibly damaging 0.50
R6179:Ccr2 UTSW 9 124105971 missense probably damaging 1.00
R6933:Ccr2 UTSW 9 124106124 missense probably damaging 1.00
R7515:Ccr2 UTSW 9 124106160 missense probably damaging 1.00
R7575:Ccr2 UTSW 9 124105806 missense probably benign
R8743:Ccr2 UTSW 9 124106094 missense probably damaging 0.99
R8746:Ccr2 UTSW 9 124106411 missense probably benign 0.00
X0026:Ccr2 UTSW 9 124105906 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGTGACAGAGACTCTTGG -3'
(R):5'- GCATAATTATAACGTTCTGGGCAC -3'

Sequencing Primer
(F):5'- TTGGAATGACACACTGCTGC -3'
(R):5'- ACCTCTGTGAAAGGGTCATTTGAC -3'
Posted On2019-09-13