Mutagenetix > Incidental Mutation

Incidental Mutation 'R7353:Vmn2r82'

570753

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r82

Ensembl Gene

ENSMUSG00000091468

Gene Name

vomeronasal 2, receptor 82

Synonyms

EG624845

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R7353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

79356576-79397198 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79396618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 817 (M817K)

Ref Sequence

ENSEMBL: ENSMUSP00000130114 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170596]

AlphaFold

G3UWA2

Predicted Effect

probably benign
Transcript: ENSMUST00000170596
AA Change: M817K

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000130114
Gene: ENSMUSG00000091468
AA Change: M817K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	79	474	6e-35	PFAM
Pfam:NCD3G	517	570	9.3e-22	PFAM
Pfam:7tm_3	603	838	6.5e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110070M22Rik	C	A	13: 119,488,178	A11S	unknown	Het
Aadacl4	G	A	4: 144,617,920	V89I	probably damaging	Het
Abcc9	T	A	6: 142,601,005	I1369F	probably damaging	Het
Adgrf3	T	A	5: 30,198,497	I427F	probably damaging	Het
Alox12e	T	C	11: 70,321,435	Y139C	probably damaging	Het
Arhgef2	T	A	3: 88,635,686	V397E	possibly damaging	Het
Arhgef28	T	A	13: 98,075,202	Y91F	probably damaging	Het
Bcar3	A	G	3: 122,512,692	T454A	probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Boc	C	T	16: 44,485,737	V1070M	unknown	Het
Ccdc88a	T	A	11: 29,463,368	N635K	probably benign	Het
Ccr2	T	C	9: 124,106,756	S358P	probably damaging	Het
Ccser2	T	C	14: 36,941,143	Q28R	possibly damaging	Het
Cenpf	T	A	1: 189,654,138	K1982*	probably null	Het
Csn1s2a	A	T	5: 87,785,302	I137F	possibly damaging	Het
Cttnbp2	A	T	6: 18,375,944	I1532K	possibly damaging	Het
Dnajc13	C	A	9: 104,230,031	R304L	possibly damaging	Het
Dopey1	T	A	9: 86,512,859	M664K	probably damaging	Het
Emilin3	T	A	2: 160,908,821	E336V	probably damaging	Het
Eml5	A	G	12: 98,825,424	Y63H		Het
Fbxo41	G	T	6: 85,479,976	R404S	possibly damaging	Het
Gm8897	G	A	5: 11,416,436	D7N	possibly damaging	Het
Gpr155	A	T	2: 73,367,491	Y456*	probably null	Het
Gpr156	T	A	16: 37,992,161	N286K	probably damaging	Het
Kcna5	A	G	6: 126,534,845	S107P	probably benign	Het
Kcne2	A	T	16: 92,296,822	H79L	possibly damaging	Het
Kcnh4	T	A	11: 100,757,199	M113L	probably benign	Het
Lad1	T	A	1: 135,827,775	L263Q	probably damaging	Het
Lctl	G	A	9: 64,126,967	G296D	probably damaging	Het
Lmtk3	A	T	7: 45,788,000	I205F	possibly damaging	Het
Magel2	G	T	7: 62,379,331	R661L	unknown	Het
Mcm10	G	A	2: 5,007,109	P180S	possibly damaging	Het
Mia3	G	T	1: 183,327,392	A446D		Het
N4bp2	G	A	5: 65,806,371	V588M	probably benign	Het
Naip6	C	T	13: 100,299,751	V755M	probably benign	Het
Neurl1a	T	C	19: 47,240,660	V213A	probably damaging	Het
Nrd1	A	G	4: 109,039,749	T522A	probably damaging	Het
Ntng1	T	C	3: 110,135,447	Q21R	probably damaging	Het
Nup160	T	C	2: 90,703,952	L707S	probably damaging	Het
Oas2	A	T	5: 120,738,522	V452D	probably damaging	Het
Olfr3	A	G	2: 36,812,903	L63P	probably damaging	Het
Olfr350	A	T	2: 36,850,069	M8L	probably benign	Het
Olfr351	G	A	2: 36,859,668	R227*	probably null	Het
Olfr519	A	G	7: 108,894,222	F67L	probably damaging	Het
Olfr593	A	C	7: 103,212,309	T150P	probably damaging	Het
Plekhg1	A	T	10: 3,964,327	T1405S		Het
Pnrc1	G	A	4: 33,248,300	P33L	probably damaging	Het
Prkag2	A	T	5: 24,880,686	V312E	possibly damaging	Het
Rps17	T	A	7: 81,344,345	E76V	possibly damaging	Het
Rsph10b	G	A	5: 143,967,220	G672S	possibly damaging	Het
Slc2a13	T	C	15: 91,321,604	N460S	probably benign	Het
Slco2b1	A	T	7: 99,690,557	C56S	possibly damaging	Het
Spn	T	C	7: 127,137,006	T110A	probably benign	Het
Sult2a8	T	C	7: 14,413,715	N217S	possibly damaging	Het
Tbx2	C	A	11: 85,833,489	T128N	probably damaging	Het
Tecpr2	A	T	12: 110,967,844	M1313L	probably benign	Het
Tmc2	G	A	2: 130,196,577		probably null	Het
Tstd1	G	T	1: 171,419,955	A69S	probably damaging	Het
Txnrd3	A	G	6: 89,661,585	D252G	probably benign	Het
Ulk2	T	C	11: 61,819,348	N345D	probably damaging	Het
Unc13c	T	C	9: 73,574,073	D1694G	probably benign	Het
Vill	T	C	9: 119,065,493	V406A	probably damaging	Het
Vmn2r115	T	C	17: 23,345,913	V258A	possibly damaging	Het
Xpnpep3	T	C	15: 81,430,887	S263P	probably benign	Het
Zfp980	A	G	4: 145,702,144	D481G	probably benign	Het
Zmpste24	A	G	4: 121,095,581	S81P	probably damaging	Het
Znrf4	A	G	17: 56,512,169	V46A	probably benign	Het

Other mutations in Vmn2r82

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01800:Vmn2r82	APN	10	79356747	missense	probably benign	0.03
IGL01860:Vmn2r82	APN	10	79378857	missense	probably benign	0.18
IGL01927:Vmn2r82	APN	10	79378072	missense	probably damaging	1.00
IGL01929:Vmn2r82	APN	10	79378711	missense	probably damaging	1.00
IGL02028:Vmn2r82	APN	10	79379223	missense	probably benign
IGL02112:Vmn2r82	APN	10	79395999	missense	probably benign	0.19
IGL02632:Vmn2r82	APN	10	79356708	missense	probably benign	0.45
IGL02665:Vmn2r82	APN	10	79379371	missense	probably damaging	0.99
IGL02716:Vmn2r82	APN	10	79377844	missense	probably benign	0.20
IGL03030:Vmn2r82	APN	10	79381315	missense	possibly damaging	0.85
IGL03190:Vmn2r82	APN	10	79356809	splice site	probably null
IGL03349:Vmn2r82	APN	10	79377869	missense	probably benign	0.25
IGL03048:Vmn2r82	UTSW	10	79396626	missense	probably damaging	0.98
R0080:Vmn2r82	UTSW	10	79396505	missense	probably benign	0.00
R0193:Vmn2r82	UTSW	10	79381295	missense	probably damaging	1.00
R0217:Vmn2r82	UTSW	10	79378800	missense	possibly damaging	0.46
R0285:Vmn2r82	UTSW	10	79396557	missense	probably damaging	1.00
R1193:Vmn2r82	UTSW	10	79377905	nonsense	probably null
R1385:Vmn2r82	UTSW	10	79396491	nonsense	probably null
R1386:Vmn2r82	UTSW	10	79378711	missense	probably damaging	1.00
R1442:Vmn2r82	UTSW	10	79379367	missense	probably benign	0.03
R1467:Vmn2r82	UTSW	10	79396299	missense	probably benign	0.00
R1467:Vmn2r82	UTSW	10	79396299	missense	probably benign	0.00
R1518:Vmn2r82	UTSW	10	79378868	missense	probably damaging	1.00
R1538:Vmn2r82	UTSW	10	79356744	missense	possibly damaging	0.92
R1607:Vmn2r82	UTSW	10	79379419	missense	possibly damaging	0.67
R1812:Vmn2r82	UTSW	10	79379212	missense	probably benign	0.33
R1906:Vmn2r82	UTSW	10	79396510	missense	probably damaging	1.00
R1954:Vmn2r82	UTSW	10	79396056	missense	probably damaging	1.00
R1972:Vmn2r82	UTSW	10	79378846	missense	probably damaging	1.00
R2093:Vmn2r82	UTSW	10	79395979	missense	probably benign	0.30
R2156:Vmn2r82	UTSW	10	79378888	missense	probably damaging	1.00
R2202:Vmn2r82	UTSW	10	79356685	missense	probably benign
R2442:Vmn2r82	UTSW	10	79385376	missense	probably damaging	1.00
R2444:Vmn2r82	UTSW	10	79377868	missense	possibly damaging	0.65
R2857:Vmn2r82	UTSW	10	79381256	missense	probably damaging	0.98
R2858:Vmn2r82	UTSW	10	79381256	missense	probably damaging	0.98
R2884:Vmn2r82	UTSW	10	79396248	missense	probably benign	0.00
R2886:Vmn2r82	UTSW	10	79396248	missense	probably benign	0.00
R4369:Vmn2r82	UTSW	10	79396080	missense	probably benign	0.01
R4445:Vmn2r82	UTSW	10	79379040	missense	possibly damaging	0.87
R4589:Vmn2r82	UTSW	10	79356714	missense	probably damaging	1.00
R4703:Vmn2r82	UTSW	10	79378807	missense	probably damaging	1.00
R4908:Vmn2r82	UTSW	10	79378755	missense	probably benign	0.00
R4937:Vmn2r82	UTSW	10	79379176	missense	probably benign	0.01
R5199:Vmn2r82	UTSW	10	79396087	missense	probably damaging	1.00
R5391:Vmn2r82	UTSW	10	79356657	missense	probably null	0.01
R5601:Vmn2r82	UTSW	10	79396191	missense	probably damaging	1.00
R5635:Vmn2r82	UTSW	10	79378818	missense	probably benign	0.33
R6065:Vmn2r82	UTSW	10	79385376	missense	probably damaging	1.00
R6074:Vmn2r82	UTSW	10	79396543	missense	probably damaging	1.00
R6340:Vmn2r82	UTSW	10	79395893	missense	probably benign	0.00
R6474:Vmn2r82	UTSW	10	79379037	missense	possibly damaging	0.55
R6995:Vmn2r82	UTSW	10	79396543	missense	probably damaging	1.00
R7111:Vmn2r82	UTSW	10	79378771	missense	probably benign	0.22
R7212:Vmn2r82	UTSW	10	79379434	missense	probably benign	0.00
R7335:Vmn2r82	UTSW	10	79378888	missense	probably damaging	1.00
R7354:Vmn2r82	UTSW	10	79356630	missense	probably benign	0.00
R7362:Vmn2r82	UTSW	10	79396617	missense	probably benign	0.00
R7378:Vmn2r82	UTSW	10	79396442	nonsense	probably null
R7430:Vmn2r82	UTSW	10	79381253	missense	probably damaging	1.00
R7509:Vmn2r82	UTSW	10	79396008	missense	possibly damaging	0.82
R7874:Vmn2r82	UTSW	10	79396511	missense	probably damaging	1.00
R7943:Vmn2r82	UTSW	10	79396245	missense	possibly damaging	0.74
R8158:Vmn2r82	UTSW	10	79377802	missense	probably benign	0.12
R8324:Vmn2r82	UTSW	10	79378893	nonsense	probably null
R8340:Vmn2r82	UTSW	10	79381202	missense	probably benign	0.00
R8787:Vmn2r82	UTSW	10	79378060	missense	probably damaging	1.00
R8929:Vmn2r82	UTSW	10	79396707	missense	probably benign	0.00
R9018:Vmn2r82	UTSW	10	79396705	missense	probably damaging	1.00
R9399:Vmn2r82	UTSW	10	79378934	nonsense	probably null
R9517:Vmn2r82	UTSW	10	79377807	nonsense	probably null
R9587:Vmn2r82	UTSW	10	79379102	missense	possibly damaging	0.70
R9602:Vmn2r82	UTSW	10	79379046	missense	probably benign	0.07
Z1088:Vmn2r82	UTSW	10	79356622	missense	probably damaging	1.00
Z1177:Vmn2r82	UTSW	10	79356595	missense	probably benign	0.03
Z1177:Vmn2r82	UTSW	10	79396535	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTGCACTCTGGCTTACCTGG -3'
(R):5'- TTGACTGTCATAATGGTTGAGACCTAG -3'

Sequencing Primer
(F):5'- ACTCTGGCTTACCTGGGAGTC -3'
(R):5'- AAAGTTTTGCTCCTGTGGT -3'

Posted On

2019-09-13