Incidental Mutation 'R7353:Vmn2r82'
ID 570753
Institutional Source Beutler Lab
Gene Symbol Vmn2r82
Ensembl Gene ENSMUSG00000091468
Gene Name vomeronasal 2, receptor 82
Synonyms EG624845
MMRRC Submission 045439-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 79192425-79232600 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79232452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 817 (M817K)
Ref Sequence ENSEMBL: ENSMUSP00000130114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170596]
AlphaFold G3UWA2
Predicted Effect probably benign
Transcript: ENSMUST00000170596
AA Change: M817K

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130114
Gene: ENSMUSG00000091468
AA Change: M817K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 6e-35 PFAM
Pfam:NCD3G 517 570 9.3e-22 PFAM
Pfam:7tm_3 603 838 6.5e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,624,714 (GRCm39) A11S unknown Het
Aadacl4 G A 4: 144,344,490 (GRCm39) V89I probably damaging Het
Abcc9 T A 6: 142,546,731 (GRCm39) I1369F probably damaging Het
Adgrf3 T A 5: 30,403,495 (GRCm39) I427F probably damaging Het
Alox12e T C 11: 70,212,261 (GRCm39) Y139C probably damaging Het
Arhgef2 T A 3: 88,542,993 (GRCm39) V397E possibly damaging Het
Arhgef28 T A 13: 98,211,710 (GRCm39) Y91F probably damaging Het
Bcar3 A G 3: 122,306,341 (GRCm39) T454A probably benign Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Boc C T 16: 44,306,100 (GRCm39) V1070M unknown Het
Ccdc88a T A 11: 29,413,368 (GRCm39) N635K probably benign Het
Ccr2 T C 9: 123,906,793 (GRCm39) S358P probably damaging Het
Ccser2 T C 14: 36,663,100 (GRCm39) Q28R possibly damaging Het
Cenpf T A 1: 189,386,335 (GRCm39) K1982* probably null Het
Csn1s2a A T 5: 87,933,161 (GRCm39) I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,943 (GRCm39) I1532K possibly damaging Het
Dnajc13 C A 9: 104,107,230 (GRCm39) R304L possibly damaging Het
Dop1a T A 9: 86,394,912 (GRCm39) M664K probably damaging Het
Emilin3 T A 2: 160,750,741 (GRCm39) E336V probably damaging Het
Eml5 A G 12: 98,791,683 (GRCm39) Y63H Het
Fbxo41 G T 6: 85,456,958 (GRCm39) R404S possibly damaging Het
Gpr155 A T 2: 73,197,835 (GRCm39) Y456* probably null Het
Gpr156 T A 16: 37,812,523 (GRCm39) N286K probably damaging Het
Kcna5 A G 6: 126,511,808 (GRCm39) S107P probably benign Het
Kcne2 A T 16: 92,093,710 (GRCm39) H79L possibly damaging Het
Kcnh4 T A 11: 100,648,025 (GRCm39) M113L probably benign Het
Lad1 T A 1: 135,755,513 (GRCm39) L263Q probably damaging Het
Lctl G A 9: 64,034,249 (GRCm39) G296D probably damaging Het
Lmtk3 A T 7: 45,437,424 (GRCm39) I205F possibly damaging Het
Magel2 G T 7: 62,029,079 (GRCm39) R661L unknown Het
Mcm10 G A 2: 5,011,920 (GRCm39) P180S possibly damaging Het
Mia3 G T 1: 183,108,247 (GRCm39) A446D Het
N4bp2 G A 5: 65,963,714 (GRCm39) V588M probably benign Het
Naip6 C T 13: 100,436,259 (GRCm39) V755M probably benign Het
Neurl1a T C 19: 47,229,099 (GRCm39) V213A probably damaging Het
Nrdc A G 4: 108,896,946 (GRCm39) T522A probably damaging Het
Ntng1 T C 3: 110,042,763 (GRCm39) Q21R probably damaging Het
Nup160 T C 2: 90,534,296 (GRCm39) L707S probably damaging Het
Oas2 A T 5: 120,876,587 (GRCm39) V452D probably damaging Het
Or10a3n A G 7: 108,493,429 (GRCm39) F67L probably damaging Het
Or1j1 A G 2: 36,702,915 (GRCm39) L63P probably damaging Het
Or1j4 A T 2: 36,740,081 (GRCm39) M8L probably benign Het
Or1n1 G A 2: 36,749,680 (GRCm39) R227* probably null Het
Or52s1 A C 7: 102,861,516 (GRCm39) T150P probably damaging Het
Plekhg1 A T 10: 3,914,327 (GRCm39) T1405S Het
Pnrc1 G A 4: 33,248,300 (GRCm39) P33L probably damaging Het
Prkag2 A T 5: 25,085,684 (GRCm39) V312E possibly damaging Het
Rps17 T A 7: 80,994,093 (GRCm39) E76V possibly damaging Het
Rsph10b G A 5: 143,904,038 (GRCm39) G672S possibly damaging Het
Slc2a13 T C 15: 91,205,807 (GRCm39) N460S probably benign Het
Slco2b1 A T 7: 99,339,764 (GRCm39) C56S possibly damaging Het
Speer1f G A 5: 11,466,403 (GRCm39) D7N possibly damaging Het
Spn T C 7: 126,736,178 (GRCm39) T110A probably benign Het
Sult2a8 T C 7: 14,147,640 (GRCm39) N217S possibly damaging Het
Tbx2 C A 11: 85,724,315 (GRCm39) T128N probably damaging Het
Tecpr2 A T 12: 110,934,278 (GRCm39) M1313L probably benign Het
Tmc2 G A 2: 130,038,497 (GRCm39) probably null Het
Tstd1 G T 1: 171,247,523 (GRCm39) A69S probably damaging Het
Txnrd3 A G 6: 89,638,567 (GRCm39) D252G probably benign Het
Ulk2 T C 11: 61,710,174 (GRCm39) N345D probably damaging Het
Unc13c T C 9: 73,481,355 (GRCm39) D1694G probably benign Het
Vill T C 9: 118,894,561 (GRCm39) V406A probably damaging Het
Vmn2r115 T C 17: 23,564,887 (GRCm39) V258A possibly damaging Het
Xpnpep3 T C 15: 81,315,088 (GRCm39) S263P probably benign Het
Zfp980 A G 4: 145,428,714 (GRCm39) D481G probably benign Het
Zmpste24 A G 4: 120,952,778 (GRCm39) S81P probably damaging Het
Znrf4 A G 17: 56,819,169 (GRCm39) V46A probably benign Het
Other mutations in Vmn2r82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Vmn2r82 APN 10 79,192,581 (GRCm39) missense probably benign 0.03
IGL01860:Vmn2r82 APN 10 79,214,691 (GRCm39) missense probably benign 0.18
IGL01927:Vmn2r82 APN 10 79,213,906 (GRCm39) missense probably damaging 1.00
IGL01929:Vmn2r82 APN 10 79,214,545 (GRCm39) missense probably damaging 1.00
IGL02028:Vmn2r82 APN 10 79,215,057 (GRCm39) missense probably benign
IGL02112:Vmn2r82 APN 10 79,231,833 (GRCm39) missense probably benign 0.19
IGL02632:Vmn2r82 APN 10 79,192,542 (GRCm39) missense probably benign 0.45
IGL02665:Vmn2r82 APN 10 79,215,205 (GRCm39) missense probably damaging 0.99
IGL02716:Vmn2r82 APN 10 79,213,678 (GRCm39) missense probably benign 0.20
IGL03030:Vmn2r82 APN 10 79,217,149 (GRCm39) missense possibly damaging 0.85
IGL03190:Vmn2r82 APN 10 79,192,643 (GRCm39) splice site probably null
IGL03349:Vmn2r82 APN 10 79,213,703 (GRCm39) missense probably benign 0.25
IGL03048:Vmn2r82 UTSW 10 79,232,460 (GRCm39) missense probably damaging 0.98
R0080:Vmn2r82 UTSW 10 79,232,339 (GRCm39) missense probably benign 0.00
R0193:Vmn2r82 UTSW 10 79,217,129 (GRCm39) missense probably damaging 1.00
R0217:Vmn2r82 UTSW 10 79,214,634 (GRCm39) missense possibly damaging 0.46
R0285:Vmn2r82 UTSW 10 79,232,391 (GRCm39) missense probably damaging 1.00
R1193:Vmn2r82 UTSW 10 79,213,739 (GRCm39) nonsense probably null
R1385:Vmn2r82 UTSW 10 79,232,325 (GRCm39) nonsense probably null
R1386:Vmn2r82 UTSW 10 79,214,545 (GRCm39) missense probably damaging 1.00
R1442:Vmn2r82 UTSW 10 79,215,201 (GRCm39) missense probably benign 0.03
R1467:Vmn2r82 UTSW 10 79,232,133 (GRCm39) missense probably benign 0.00
R1467:Vmn2r82 UTSW 10 79,232,133 (GRCm39) missense probably benign 0.00
R1518:Vmn2r82 UTSW 10 79,214,702 (GRCm39) missense probably damaging 1.00
R1538:Vmn2r82 UTSW 10 79,192,578 (GRCm39) missense possibly damaging 0.92
R1607:Vmn2r82 UTSW 10 79,215,253 (GRCm39) missense possibly damaging 0.67
R1812:Vmn2r82 UTSW 10 79,215,046 (GRCm39) missense probably benign 0.33
R1906:Vmn2r82 UTSW 10 79,232,344 (GRCm39) missense probably damaging 1.00
R1954:Vmn2r82 UTSW 10 79,231,890 (GRCm39) missense probably damaging 1.00
R1972:Vmn2r82 UTSW 10 79,214,680 (GRCm39) missense probably damaging 1.00
R2093:Vmn2r82 UTSW 10 79,231,813 (GRCm39) missense probably benign 0.30
R2156:Vmn2r82 UTSW 10 79,214,722 (GRCm39) missense probably damaging 1.00
R2202:Vmn2r82 UTSW 10 79,192,519 (GRCm39) missense probably benign
R2442:Vmn2r82 UTSW 10 79,221,210 (GRCm39) missense probably damaging 1.00
R2444:Vmn2r82 UTSW 10 79,213,702 (GRCm39) missense possibly damaging 0.65
R2857:Vmn2r82 UTSW 10 79,217,090 (GRCm39) missense probably damaging 0.98
R2858:Vmn2r82 UTSW 10 79,217,090 (GRCm39) missense probably damaging 0.98
R2884:Vmn2r82 UTSW 10 79,232,082 (GRCm39) missense probably benign 0.00
R2886:Vmn2r82 UTSW 10 79,232,082 (GRCm39) missense probably benign 0.00
R4369:Vmn2r82 UTSW 10 79,231,914 (GRCm39) missense probably benign 0.01
R4445:Vmn2r82 UTSW 10 79,214,874 (GRCm39) missense possibly damaging 0.87
R4589:Vmn2r82 UTSW 10 79,192,548 (GRCm39) missense probably damaging 1.00
R4703:Vmn2r82 UTSW 10 79,214,641 (GRCm39) missense probably damaging 1.00
R4908:Vmn2r82 UTSW 10 79,214,589 (GRCm39) missense probably benign 0.00
R4937:Vmn2r82 UTSW 10 79,215,010 (GRCm39) missense probably benign 0.01
R5199:Vmn2r82 UTSW 10 79,231,921 (GRCm39) missense probably damaging 1.00
R5391:Vmn2r82 UTSW 10 79,192,491 (GRCm39) missense probably null 0.01
R5601:Vmn2r82 UTSW 10 79,232,025 (GRCm39) missense probably damaging 1.00
R5635:Vmn2r82 UTSW 10 79,214,652 (GRCm39) missense probably benign 0.33
R6065:Vmn2r82 UTSW 10 79,221,210 (GRCm39) missense probably damaging 1.00
R6074:Vmn2r82 UTSW 10 79,232,377 (GRCm39) missense probably damaging 1.00
R6340:Vmn2r82 UTSW 10 79,231,727 (GRCm39) missense probably benign 0.00
R6474:Vmn2r82 UTSW 10 79,214,871 (GRCm39) missense possibly damaging 0.55
R6995:Vmn2r82 UTSW 10 79,232,377 (GRCm39) missense probably damaging 1.00
R7111:Vmn2r82 UTSW 10 79,214,605 (GRCm39) missense probably benign 0.22
R7212:Vmn2r82 UTSW 10 79,215,268 (GRCm39) missense probably benign 0.00
R7335:Vmn2r82 UTSW 10 79,214,722 (GRCm39) missense probably damaging 1.00
R7354:Vmn2r82 UTSW 10 79,192,464 (GRCm39) missense probably benign 0.00
R7362:Vmn2r82 UTSW 10 79,232,451 (GRCm39) missense probably benign 0.00
R7378:Vmn2r82 UTSW 10 79,232,276 (GRCm39) nonsense probably null
R7430:Vmn2r82 UTSW 10 79,217,087 (GRCm39) missense probably damaging 1.00
R7509:Vmn2r82 UTSW 10 79,231,842 (GRCm39) missense possibly damaging 0.82
R7874:Vmn2r82 UTSW 10 79,232,345 (GRCm39) missense probably damaging 1.00
R7943:Vmn2r82 UTSW 10 79,232,079 (GRCm39) missense possibly damaging 0.74
R8158:Vmn2r82 UTSW 10 79,213,636 (GRCm39) missense probably benign 0.12
R8324:Vmn2r82 UTSW 10 79,214,727 (GRCm39) nonsense probably null
R8340:Vmn2r82 UTSW 10 79,217,036 (GRCm39) missense probably benign 0.00
R8787:Vmn2r82 UTSW 10 79,213,894 (GRCm39) missense probably damaging 1.00
R8929:Vmn2r82 UTSW 10 79,232,541 (GRCm39) missense probably benign 0.00
R9018:Vmn2r82 UTSW 10 79,232,539 (GRCm39) missense probably damaging 1.00
R9399:Vmn2r82 UTSW 10 79,214,768 (GRCm39) nonsense probably null
R9517:Vmn2r82 UTSW 10 79,213,641 (GRCm39) nonsense probably null
R9587:Vmn2r82 UTSW 10 79,214,936 (GRCm39) missense possibly damaging 0.70
R9602:Vmn2r82 UTSW 10 79,214,880 (GRCm39) missense probably benign 0.07
Z1088:Vmn2r82 UTSW 10 79,192,456 (GRCm39) missense probably damaging 1.00
Z1177:Vmn2r82 UTSW 10 79,232,369 (GRCm39) missense probably damaging 1.00
Z1177:Vmn2r82 UTSW 10 79,192,429 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TACTGCACTCTGGCTTACCTGG -3'
(R):5'- TTGACTGTCATAATGGTTGAGACCTAG -3'

Sequencing Primer
(F):5'- ACTCTGGCTTACCTGGGAGTC -3'
(R):5'- AAAGTTTTGCTCCTGTGGT -3'
Posted On 2019-09-13