Mutagenetix > Incidental Mutation

Incidental Mutation 'R7353:Ulk2'

570755

Institutional Source

Beutler Lab

Gene Symbol

Ulk2

Ensembl Gene

ENSMUSG00000004798

Gene Name

unc-51 like kinase 2

Synonyms

Unc51.2, A830085I22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.247) question?

Stock #

R7353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

61775649-61855073 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61819348 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 345 (N345D)

Ref Sequence

ENSEMBL: ENSMUSP00000004920 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004920]

AlphaFold

Q9QY01

Predicted Effect

probably damaging
Transcript: ENSMUST00000004920
AA Change: N345D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004920
Gene: ENSMUSG00000004798
AA Change: N345D

Domain	Start	End	E-Value	Type
S_TKc	9	271	1.1e-93	SMART
low complexity region	274	309	N/A	INTRINSIC
Blast:S_TKc	310	413	9e-28	BLAST
Blast:S_TKc	433	738	1e-29	BLAST
low complexity region	751	766	N/A	INTRINSIC
low complexity region	771	791	N/A	INTRINSIC
Pfam:DUF3543	821	1032	1.8e-31	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a serine/threonine kinase in C. elegans which is involved in axonal elongation. The structure of this protein is similar to the C. elegans protein in that both proteins have an N-terminal kinase domain, a central proline/serine rich (PS) domain, and a C-terminal (C) domain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in an increased anxiety-like response in males. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110070M22Rik	C	A	13: 119,488,178	A11S	unknown	Het
Aadacl4	G	A	4: 144,617,920	V89I	probably damaging	Het
Abcc9	T	A	6: 142,601,005	I1369F	probably damaging	Het
Adgrf3	T	A	5: 30,198,497	I427F	probably damaging	Het
Alox12e	T	C	11: 70,321,435	Y139C	probably damaging	Het
Arhgef2	T	A	3: 88,635,686	V397E	possibly damaging	Het
Arhgef28	T	A	13: 98,075,202	Y91F	probably damaging	Het
Bcar3	A	G	3: 122,512,692	T454A	probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Boc	C	T	16: 44,485,737	V1070M	unknown	Het
Ccdc88a	T	A	11: 29,463,368	N635K	probably benign	Het
Ccr2	T	C	9: 124,106,756	S358P	probably damaging	Het
Ccser2	T	C	14: 36,941,143	Q28R	possibly damaging	Het
Cenpf	T	A	1: 189,654,138	K1982*	probably null	Het
Csn1s2a	A	T	5: 87,785,302	I137F	possibly damaging	Het
Cttnbp2	A	T	6: 18,375,944	I1532K	possibly damaging	Het
Dnajc13	C	A	9: 104,230,031	R304L	possibly damaging	Het
Dopey1	T	A	9: 86,512,859	M664K	probably damaging	Het
Emilin3	T	A	2: 160,908,821	E336V	probably damaging	Het
Eml5	A	G	12: 98,825,424	Y63H		Het
Fbxo41	G	T	6: 85,479,976	R404S	possibly damaging	Het
Gm8897	G	A	5: 11,416,436	D7N	possibly damaging	Het
Gpr155	A	T	2: 73,367,491	Y456*	probably null	Het
Gpr156	T	A	16: 37,992,161	N286K	probably damaging	Het
Kcna5	A	G	6: 126,534,845	S107P	probably benign	Het
Kcne2	A	T	16: 92,296,822	H79L	possibly damaging	Het
Kcnh4	T	A	11: 100,757,199	M113L	probably benign	Het
Lad1	T	A	1: 135,827,775	L263Q	probably damaging	Het
Lctl	G	A	9: 64,126,967	G296D	probably damaging	Het
Lmtk3	A	T	7: 45,788,000	I205F	possibly damaging	Het
Magel2	G	T	7: 62,379,331	R661L	unknown	Het
Mcm10	G	A	2: 5,007,109	P180S	possibly damaging	Het
Mia3	G	T	1: 183,327,392	A446D		Het
N4bp2	G	A	5: 65,806,371	V588M	probably benign	Het
Naip6	C	T	13: 100,299,751	V755M	probably benign	Het
Neurl1a	T	C	19: 47,240,660	V213A	probably damaging	Het
Nrd1	A	G	4: 109,039,749	T522A	probably damaging	Het
Ntng1	T	C	3: 110,135,447	Q21R	probably damaging	Het
Nup160	T	C	2: 90,703,952	L707S	probably damaging	Het
Oas2	A	T	5: 120,738,522	V452D	probably damaging	Het
Olfr3	A	G	2: 36,812,903	L63P	probably damaging	Het
Olfr350	A	T	2: 36,850,069	M8L	probably benign	Het
Olfr351	G	A	2: 36,859,668	R227*	probably null	Het
Olfr519	A	G	7: 108,894,222	F67L	probably damaging	Het
Olfr593	A	C	7: 103,212,309	T150P	probably damaging	Het
Plekhg1	A	T	10: 3,964,327	T1405S		Het
Pnrc1	G	A	4: 33,248,300	P33L	probably damaging	Het
Prkag2	A	T	5: 24,880,686	V312E	possibly damaging	Het
Rps17	T	A	7: 81,344,345	E76V	possibly damaging	Het
Rsph10b	G	A	5: 143,967,220	G672S	possibly damaging	Het
Slc2a13	T	C	15: 91,321,604	N460S	probably benign	Het
Slco2b1	A	T	7: 99,690,557	C56S	possibly damaging	Het
Spn	T	C	7: 127,137,006	T110A	probably benign	Het
Sult2a8	T	C	7: 14,413,715	N217S	possibly damaging	Het
Tbx2	C	A	11: 85,833,489	T128N	probably damaging	Het
Tecpr2	A	T	12: 110,967,844	M1313L	probably benign	Het
Tmc2	G	A	2: 130,196,577		probably null	Het
Tstd1	G	T	1: 171,419,955	A69S	probably damaging	Het
Txnrd3	A	G	6: 89,661,585	D252G	probably benign	Het
Unc13c	T	C	9: 73,574,073	D1694G	probably benign	Het
Vill	T	C	9: 119,065,493	V406A	probably damaging	Het
Vmn2r115	T	C	17: 23,345,913	V258A	possibly damaging	Het
Vmn2r82	T	A	10: 79,396,618	M817K	probably benign	Het
Xpnpep3	T	C	15: 81,430,887	S263P	probably benign	Het
Zfp980	A	G	4: 145,702,144	D481G	probably benign	Het
Zmpste24	A	G	4: 121,095,581	S81P	probably damaging	Het
Znrf4	A	G	17: 56,512,169	V46A	probably benign	Het

Other mutations in Ulk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Ulk2	APN	11	61791436	nonsense	probably null
IGL02044:Ulk2	APN	11	61781639	missense	probably damaging	1.00
IGL02185:Ulk2	APN	11	61782060	missense	probably damaging	1.00
IGL03036:Ulk2	APN	11	61834834	missense	probably damaging	1.00
BB007:Ulk2	UTSW	11	61791432	critical splice donor site	probably null
BB009:Ulk2	UTSW	11	61808090	missense	probably benign
BB017:Ulk2	UTSW	11	61791432	critical splice donor site	probably null
BB019:Ulk2	UTSW	11	61808090	missense	probably benign
R0207:Ulk2	UTSW	11	61777785	missense	probably benign	0.42
R0362:Ulk2	UTSW	11	61787586	missense	probably benign
R0657:Ulk2	UTSW	11	61808054	splice site	probably benign
R1076:Ulk2	UTSW	11	61819309	missense	probably damaging	1.00
R1144:Ulk2	UTSW	11	61800060	missense	possibly damaging	0.80
R1573:Ulk2	UTSW	11	61779755	missense	probably damaging	1.00
R1583:Ulk2	UTSW	11	61783545	missense	possibly damaging	0.95
R1619:Ulk2	UTSW	11	61781746	missense	probably damaging	1.00
R1757:Ulk2	UTSW	11	61841339	splice site	probably benign
R1845:Ulk2	UTSW	11	61812738	missense	probably benign	0.04
R1883:Ulk2	UTSW	11	61830612	missense	probably damaging	1.00
R1966:Ulk2	UTSW	11	61819471	splice site	probably null
R2177:Ulk2	UTSW	11	61791509	missense	probably benign	0.01
R2416:Ulk2	UTSW	11	61782039	missense	probably damaging	1.00
R2509:Ulk2	UTSW	11	61787514	missense	probably benign	0.00
R2847:Ulk2	UTSW	11	61824729	critical splice acceptor site	probably null
R4736:Ulk2	UTSW	11	61833435	missense	probably damaging	1.00
R4997:Ulk2	UTSW	11	61799156	missense	probably benign	0.00
R5081:Ulk2	UTSW	11	61803662	missense	probably damaging	1.00
R5190:Ulk2	UTSW	11	61781711	missense	probably benign
R5346:Ulk2	UTSW	11	61834914	missense	probably damaging	1.00
R5348:Ulk2	UTSW	11	61783613	missense	probably benign
R5520:Ulk2	UTSW	11	61808144	missense	probably damaging	1.00
R5954:Ulk2	UTSW	11	61803796	splice site	probably benign
R6153:Ulk2	UTSW	11	61781746	missense	probably damaging	1.00
R6223:Ulk2	UTSW	11	61787504	nonsense	probably null
R7204:Ulk2	UTSW	11	61783631	missense	probably benign	0.11
R7205:Ulk2	UTSW	11	61834831	missense	possibly damaging	0.84
R7259:Ulk2	UTSW	11	61782083	missense	probably damaging	1.00
R7734:Ulk2	UTSW	11	61853301	nonsense	probably null
R7797:Ulk2	UTSW	11	61782102	missense	probably benign	0.06
R7808:Ulk2	UTSW	11	61854552	missense	probably damaging	1.00
R7930:Ulk2	UTSW	11	61791432	critical splice donor site	probably null
R7932:Ulk2	UTSW	11	61808090	missense	probably benign
R8882:Ulk2	UTSW	11	61808061	critical splice donor site	probably null
R8909:Ulk2	UTSW	11	61799554	missense	probably benign
R9704:Ulk2	UTSW	11	61825868	missense	probably damaging	1.00
X0028:Ulk2	UTSW	11	61799568	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCTAAGTTCACTCAACCTGG -3'
(R):5'- ACCTTAGATGGGCGTTTATTCCC -3'

Sequencing Primer
(F):5'- TCTACATGGGGAGAAGCCTCTC -3'
(R):5'- GTCCCTTCCAGATATGCA -3'

Posted On

2019-09-13