Incidental Mutation 'R7353:Tbx2'
ID 570757
Institutional Source Beutler Lab
Gene Symbol Tbx2
Ensembl Gene ENSMUSG00000000093
Gene Name T-box 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 85832551-85841948 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 85833489 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 128 (T128N)
Ref Sequence ENSEMBL: ENSMUSP00000000095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000095]
AlphaFold Q60707
Predicted Effect probably damaging
Transcript: ENSMUST00000000095
AA Change: T128N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000095
Gene: ENSMUSG00000000093
AA Change: T128N

DomainStartEndE-ValueType
low complexity region 28 75 N/A INTRINSIC
TBOX 104 292 2.44e-130 SMART
Pfam:TBX 305 382 1.5e-18 PFAM
low complexity region 391 408 N/A INTRINSIC
low complexity region 509 549 N/A INTRINSIC
SCOP:d1gkub1 582 612 5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene product is the human homolog of mouse Tbx2, and shares strong sequence similarity with Drosophila omb protein. Expression studies indicate that this gene may have a potential role in tumorigenesis as an immortalizing agent. Transcript heterogeneity due to alternative polyadenylation has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal cardiac and vascular development, edema, and polydactyly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Tbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02499:Tbx2 APN 11 85840913 missense possibly damaging 0.82
PIT4480001:Tbx2 UTSW 11 85834735 missense probably damaging 1.00
R1295:Tbx2 UTSW 11 85834766 missense probably damaging 0.97
R1296:Tbx2 UTSW 11 85834766 missense probably damaging 0.97
R1384:Tbx2 UTSW 11 85833492 missense probably benign 0.01
R1501:Tbx2 UTSW 11 85834796 missense probably damaging 1.00
R3949:Tbx2 UTSW 11 85838275 nonsense probably null
R4451:Tbx2 UTSW 11 85840817 missense probably damaging 1.00
R5214:Tbx2 UTSW 11 85838437 missense probably benign 0.02
R5690:Tbx2 UTSW 11 85837053 missense probably damaging 1.00
R6186:Tbx2 UTSW 11 85837846 nonsense probably null
R7211:Tbx2 UTSW 11 85834714 missense probably damaging 1.00
R7529:Tbx2 UTSW 11 85840901 missense probably benign 0.02
R7573:Tbx2 UTSW 11 85833312 missense possibly damaging 0.70
R7626:Tbx2 UTSW 11 85840796 missense probably benign 0.00
R7762:Tbx2 UTSW 11 85835901 missense probably damaging 1.00
R7996:Tbx2 UTSW 11 85834790 missense probably damaging 1.00
R8932:Tbx2 UTSW 11 85834707 missense probably damaging 0.98
R9504:Tbx2 UTSW 11 85833212 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGTCCCGATGAGAGAGCC -3'
(R):5'- ACAGTTGGGACTATTCTTTAGGAAC -3'

Sequencing Primer
(F):5'- CAGCGCCATGGCTTACC -3'
(R):5'- GCAATCCGAGAGAGCAT -3'
Posted On 2019-09-13