Incidental Mutation 'R7353:Eml5'
ID 570759
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 045439-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 98753064-98867743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98791683 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 63 (Y63H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: Y1239H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: Y1239H

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000223282
AA Change: Y1278H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,624,714 (GRCm39) A11S unknown Het
Aadacl4 G A 4: 144,344,490 (GRCm39) V89I probably damaging Het
Abcc9 T A 6: 142,546,731 (GRCm39) I1369F probably damaging Het
Adgrf3 T A 5: 30,403,495 (GRCm39) I427F probably damaging Het
Alox12e T C 11: 70,212,261 (GRCm39) Y139C probably damaging Het
Arhgef2 T A 3: 88,542,993 (GRCm39) V397E possibly damaging Het
Arhgef28 T A 13: 98,211,710 (GRCm39) Y91F probably damaging Het
Bcar3 A G 3: 122,306,341 (GRCm39) T454A probably benign Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Boc C T 16: 44,306,100 (GRCm39) V1070M unknown Het
Ccdc88a T A 11: 29,413,368 (GRCm39) N635K probably benign Het
Ccr2 T C 9: 123,906,793 (GRCm39) S358P probably damaging Het
Ccser2 T C 14: 36,663,100 (GRCm39) Q28R possibly damaging Het
Cenpf T A 1: 189,386,335 (GRCm39) K1982* probably null Het
Csn1s2a A T 5: 87,933,161 (GRCm39) I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,943 (GRCm39) I1532K possibly damaging Het
Dnajc13 C A 9: 104,107,230 (GRCm39) R304L possibly damaging Het
Dop1a T A 9: 86,394,912 (GRCm39) M664K probably damaging Het
Emilin3 T A 2: 160,750,741 (GRCm39) E336V probably damaging Het
Fbxo41 G T 6: 85,456,958 (GRCm39) R404S possibly damaging Het
Gpr155 A T 2: 73,197,835 (GRCm39) Y456* probably null Het
Gpr156 T A 16: 37,812,523 (GRCm39) N286K probably damaging Het
Kcna5 A G 6: 126,511,808 (GRCm39) S107P probably benign Het
Kcne2 A T 16: 92,093,710 (GRCm39) H79L possibly damaging Het
Kcnh4 T A 11: 100,648,025 (GRCm39) M113L probably benign Het
Lad1 T A 1: 135,755,513 (GRCm39) L263Q probably damaging Het
Lctl G A 9: 64,034,249 (GRCm39) G296D probably damaging Het
Lmtk3 A T 7: 45,437,424 (GRCm39) I205F possibly damaging Het
Magel2 G T 7: 62,029,079 (GRCm39) R661L unknown Het
Mcm10 G A 2: 5,011,920 (GRCm39) P180S possibly damaging Het
Mia3 G T 1: 183,108,247 (GRCm39) A446D Het
N4bp2 G A 5: 65,963,714 (GRCm39) V588M probably benign Het
Naip6 C T 13: 100,436,259 (GRCm39) V755M probably benign Het
Neurl1a T C 19: 47,229,099 (GRCm39) V213A probably damaging Het
Nrdc A G 4: 108,896,946 (GRCm39) T522A probably damaging Het
Ntng1 T C 3: 110,042,763 (GRCm39) Q21R probably damaging Het
Nup160 T C 2: 90,534,296 (GRCm39) L707S probably damaging Het
Oas2 A T 5: 120,876,587 (GRCm39) V452D probably damaging Het
Or10a3n A G 7: 108,493,429 (GRCm39) F67L probably damaging Het
Or1j1 A G 2: 36,702,915 (GRCm39) L63P probably damaging Het
Or1j4 A T 2: 36,740,081 (GRCm39) M8L probably benign Het
Or1n1 G A 2: 36,749,680 (GRCm39) R227* probably null Het
Or52s1 A C 7: 102,861,516 (GRCm39) T150P probably damaging Het
Plekhg1 A T 10: 3,914,327 (GRCm39) T1405S Het
Pnrc1 G A 4: 33,248,300 (GRCm39) P33L probably damaging Het
Prkag2 A T 5: 25,085,684 (GRCm39) V312E possibly damaging Het
Rps17 T A 7: 80,994,093 (GRCm39) E76V possibly damaging Het
Rsph10b G A 5: 143,904,038 (GRCm39) G672S possibly damaging Het
Slc2a13 T C 15: 91,205,807 (GRCm39) N460S probably benign Het
Slco2b1 A T 7: 99,339,764 (GRCm39) C56S possibly damaging Het
Speer1f G A 5: 11,466,403 (GRCm39) D7N possibly damaging Het
Spn T C 7: 126,736,178 (GRCm39) T110A probably benign Het
Sult2a8 T C 7: 14,147,640 (GRCm39) N217S possibly damaging Het
Tbx2 C A 11: 85,724,315 (GRCm39) T128N probably damaging Het
Tecpr2 A T 12: 110,934,278 (GRCm39) M1313L probably benign Het
Tmc2 G A 2: 130,038,497 (GRCm39) probably null Het
Tstd1 G T 1: 171,247,523 (GRCm39) A69S probably damaging Het
Txnrd3 A G 6: 89,638,567 (GRCm39) D252G probably benign Het
Ulk2 T C 11: 61,710,174 (GRCm39) N345D probably damaging Het
Unc13c T C 9: 73,481,355 (GRCm39) D1694G probably benign Het
Vill T C 9: 118,894,561 (GRCm39) V406A probably damaging Het
Vmn2r115 T C 17: 23,564,887 (GRCm39) V258A possibly damaging Het
Vmn2r82 T A 10: 79,232,452 (GRCm39) M817K probably benign Het
Xpnpep3 T C 15: 81,315,088 (GRCm39) S263P probably benign Het
Zfp980 A G 4: 145,428,714 (GRCm39) D481G probably benign Het
Zmpste24 A G 4: 120,952,778 (GRCm39) S81P probably damaging Het
Znrf4 A G 17: 56,819,169 (GRCm39) V46A probably benign Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98,839,468 (GRCm39) splice site probably benign
IGL00473:Eml5 APN 12 98,771,751 (GRCm39) splice site probably benign
IGL01120:Eml5 APN 12 98,810,278 (GRCm39) missense probably benign
IGL01308:Eml5 APN 12 98,768,572 (GRCm39) missense probably damaging 1.00
IGL01790:Eml5 APN 12 98,765,191 (GRCm39) missense probably damaging 1.00
IGL01973:Eml5 APN 12 98,829,539 (GRCm39) missense probably benign
IGL02182:Eml5 APN 12 98,768,581 (GRCm39) missense probably damaging 1.00
IGL02201:Eml5 APN 12 98,760,683 (GRCm39) splice site probably benign
IGL02375:Eml5 APN 12 98,810,346 (GRCm39) missense probably damaging 1.00
IGL02397:Eml5 APN 12 98,756,933 (GRCm39) missense probably benign 0.07
IGL02480:Eml5 APN 12 98,842,502 (GRCm39) missense probably damaging 1.00
IGL02801:Eml5 APN 12 98,784,104 (GRCm39) missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98,825,100 (GRCm39) missense probably damaging 1.00
IGL03104:Eml5 APN 12 98,827,504 (GRCm39) nonsense probably null
IGL03158:Eml5 APN 12 98,793,773 (GRCm39) splice site probably benign
IGL03286:Eml5 APN 12 98,826,762 (GRCm39) missense probably damaging 1.00
IGL03380:Eml5 APN 12 98,840,906 (GRCm39) splice site probably benign
BB010:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98,791,031 (GRCm39) splice site probably null
R0624:Eml5 UTSW 12 98,831,738 (GRCm39) missense probably damaging 1.00
R0993:Eml5 UTSW 12 98,827,442 (GRCm39) missense probably benign 0.25
R1073:Eml5 UTSW 12 98,797,232 (GRCm39) missense probably damaging 1.00
R1183:Eml5 UTSW 12 98,758,305 (GRCm39) missense probably benign 0.31
R1352:Eml5 UTSW 12 98,797,262 (GRCm39) splice site probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1503:Eml5 UTSW 12 98,797,433 (GRCm39) missense probably damaging 0.99
R1538:Eml5 UTSW 12 98,760,535 (GRCm39) missense probably damaging 0.99
R1689:Eml5 UTSW 12 98,797,194 (GRCm39) missense probably damaging 1.00
R1773:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1775:Eml5 UTSW 12 98,818,963 (GRCm39) splice site probably null
R1791:Eml5 UTSW 12 98,853,315 (GRCm39) missense probably benign 0.31
R1856:Eml5 UTSW 12 98,776,843 (GRCm39) missense probably damaging 1.00
R1919:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1957:Eml5 UTSW 12 98,826,220 (GRCm39) missense probably damaging 1.00
R1962:Eml5 UTSW 12 98,842,570 (GRCm39) missense probably damaging 0.99
R2033:Eml5 UTSW 12 98,757,645 (GRCm39) missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98,760,525 (GRCm39) missense probably benign 0.33
R2073:Eml5 UTSW 12 98,768,705 (GRCm39) missense probably damaging 0.99
R2143:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2144:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2158:Eml5 UTSW 12 98,810,205 (GRCm39) splice site probably benign
R2164:Eml5 UTSW 12 98,853,356 (GRCm39) missense probably damaging 0.99
R2175:Eml5 UTSW 12 98,842,482 (GRCm39) nonsense probably null
R2200:Eml5 UTSW 12 98,791,676 (GRCm39) missense probably damaging 1.00
R2234:Eml5 UTSW 12 98,807,840 (GRCm39) missense probably damaging 1.00
R2504:Eml5 UTSW 12 98,810,364 (GRCm39) missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2958:Eml5 UTSW 12 98,842,437 (GRCm39) missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98,847,067 (GRCm39) splice site probably null
R3118:Eml5 UTSW 12 98,831,753 (GRCm39) missense probably damaging 0.97
R3735:Eml5 UTSW 12 98,822,248 (GRCm39) missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98,782,283 (GRCm39) missense probably damaging 1.00
R3900:Eml5 UTSW 12 98,791,782 (GRCm39) missense probably damaging 1.00
R3973:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R3976:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R4105:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4107:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4108:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4109:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4258:Eml5 UTSW 12 98,831,693 (GRCm39) missense probably benign 0.01
R4381:Eml5 UTSW 12 98,782,214 (GRCm39) missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98,803,600 (GRCm39) missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98,765,111 (GRCm39) missense probably damaging 1.00
R4775:Eml5 UTSW 12 98,768,566 (GRCm39) missense probably benign 0.05
R4850:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5007:Eml5 UTSW 12 98,797,224 (GRCm39) missense probably damaging 1.00
R5092:Eml5 UTSW 12 98,758,875 (GRCm39) missense probably damaging 1.00
R5123:Eml5 UTSW 12 98,840,771 (GRCm39) missense probably damaging 1.00
R5124:Eml5 UTSW 12 98,758,301 (GRCm39) missense probably damaging 1.00
R5273:Eml5 UTSW 12 98,756,947 (GRCm39) missense probably damaging 1.00
R5369:Eml5 UTSW 12 98,825,042 (GRCm39) missense probably damaging 1.00
R5430:Eml5 UTSW 12 98,760,417 (GRCm39) missense probably damaging 1.00
R5748:Eml5 UTSW 12 98,791,814 (GRCm39) missense probably damaging 0.99
R5769:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5832:Eml5 UTSW 12 98,842,447 (GRCm39) missense probably benign
R6113:Eml5 UTSW 12 98,790,933 (GRCm39) nonsense probably null
R6131:Eml5 UTSW 12 98,827,510 (GRCm39) missense probably damaging 0.99
R6175:Eml5 UTSW 12 98,760,715 (GRCm39) missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98,829,388 (GRCm39) missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98,837,143 (GRCm39) missense probably damaging 0.98
R6375:Eml5 UTSW 12 98,765,127 (GRCm39)
R6528:Eml5 UTSW 12 98,790,896 (GRCm39) missense probably benign 0.18
R6657:Eml5 UTSW 12 98,757,664 (GRCm39) missense probably damaging 0.98
R6717:Eml5 UTSW 12 98,793,765 (GRCm39) missense probably damaging 1.00
R6751:Eml5 UTSW 12 98,831,659 (GRCm39) missense probably damaging 1.00
R6833:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6834:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6972:Eml5 UTSW 12 98,842,439 (GRCm39) missense probably benign 0.00
R7091:Eml5 UTSW 12 98,768,733 (GRCm39) missense probably benign 0.16
R7644:Eml5 UTSW 12 98,822,203 (GRCm39) missense probably benign 0.05
R7694:Eml5 UTSW 12 98,758,822 (GRCm39) missense probably damaging 0.99
R7842:Eml5 UTSW 12 98,760,394 (GRCm39) missense probably damaging 1.00
R7933:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98,758,773 (GRCm39) critical splice donor site probably null
R8198:Eml5 UTSW 12 98,825,145 (GRCm39) nonsense probably null
R8482:Eml5 UTSW 12 98,842,560 (GRCm39) missense probably damaging 1.00
R8732:Eml5 UTSW 12 98,782,218 (GRCm39) missense probably damaging 0.99
R8956:Eml5 UTSW 12 98,818,952 (GRCm39) missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98,776,829 (GRCm39) missense probably damaging 0.99
R9131:Eml5 UTSW 12 98,825,099 (GRCm39) missense probably damaging 1.00
R9258:Eml5 UTSW 12 98,810,376 (GRCm39) missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98,822,287 (GRCm39) missense probably damaging 0.99
R9276:Eml5 UTSW 12 98,765,060 (GRCm39) missense probably damaging 0.99
R9301:Eml5 UTSW 12 98,848,292 (GRCm39) nonsense probably null
R9368:Eml5 UTSW 12 98,762,837 (GRCm39) missense probably benign 0.31
R9392:Eml5 UTSW 12 98,867,199 (GRCm39) missense probably damaging 1.00
R9393:Eml5 UTSW 12 98,842,433 (GRCm39) missense probably benign 0.35
R9449:Eml5 UTSW 12 98,827,554 (GRCm39) missense probably damaging 1.00
R9570:Eml5 UTSW 12 98,782,243 (GRCm39) missense probably benign 0.15
T0722:Eml5 UTSW 12 98,807,841 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCAATGCACGCCAGTCATGAG -3'
(R):5'- CAAAAGTGTTCAGACTAGAATTGGG -3'

Sequencing Primer
(F):5'- ACAATTTTGCTGTAAAGCTGACC -3'
(R):5'- TGGGAAAGAATGTTTGGATTCAC -3'
Posted On 2019-09-13