Mutagenetix > Incidental Mutation

Incidental Mutation 'R7353:Gpr156'

570767

Institutional Source

Beutler Lab

Gene Symbol

Gpr156

Ensembl Gene

ENSMUSG00000046961

Gene Name

G protein-coupled receptor 156

Synonyms

Gababl

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37916496-38007530 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37992161 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 286 (N286K)

Ref Sequence

ENSEMBL: ENSMUSP00000055958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061274]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000061274
AA Change: N286K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055958
Gene: ENSMUSG00000046961
AA Change: N286K

Domain	Start	End	E-Value	Type
low complexity region	38	50	N/A	INTRINSIC
Pfam:7tm_3	61	313	2.6e-37	PFAM
coiled coil region	353	390	N/A	INTRINSIC
low complexity region	584	593	N/A	INTRINSIC
low complexity region	635	648	N/A	INTRINSIC
low complexity region	681	716	N/A	INTRINSIC
low complexity region	729	739	N/A	INTRINSIC
low complexity region	753	766	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G protein-coupled receptors (GPCRs) are a large superfamily of cell surface receptors characterized by 7 helical transmembrane domains, together with N-terminal extracellular and C-terminal intracellular domains.[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110070M22Rik	C	A	13: 119,488,178	A11S	unknown	Het
Aadacl4	G	A	4: 144,617,920	V89I	probably damaging	Het
Abcc9	T	A	6: 142,601,005	I1369F	probably damaging	Het
Adgrf3	T	A	5: 30,198,497	I427F	probably damaging	Het
Alox12e	T	C	11: 70,321,435	Y139C	probably damaging	Het
Arhgef2	T	A	3: 88,635,686	V397E	possibly damaging	Het
Arhgef28	T	A	13: 98,075,202	Y91F	probably damaging	Het
Bcar3	A	G	3: 122,512,692	T454A	probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Boc	C	T	16: 44,485,737	V1070M	unknown	Het
Ccdc88a	T	A	11: 29,463,368	N635K	probably benign	Het
Ccr2	T	C	9: 124,106,756	S358P	probably damaging	Het
Ccser2	T	C	14: 36,941,143	Q28R	possibly damaging	Het
Cenpf	T	A	1: 189,654,138	K1982*	probably null	Het
Csn1s2a	A	T	5: 87,785,302	I137F	possibly damaging	Het
Cttnbp2	A	T	6: 18,375,944	I1532K	possibly damaging	Het
Dnajc13	C	A	9: 104,230,031	R304L	possibly damaging	Het
Dopey1	T	A	9: 86,512,859	M664K	probably damaging	Het
Emilin3	T	A	2: 160,908,821	E336V	probably damaging	Het
Eml5	A	G	12: 98,825,424	Y63H		Het
Fbxo41	G	T	6: 85,479,976	R404S	possibly damaging	Het
Gm8897	G	A	5: 11,416,436	D7N	possibly damaging	Het
Gpr155	A	T	2: 73,367,491	Y456*	probably null	Het
Kcna5	A	G	6: 126,534,845	S107P	probably benign	Het
Kcne2	A	T	16: 92,296,822	H79L	possibly damaging	Het
Kcnh4	T	A	11: 100,757,199	M113L	probably benign	Het
Lad1	T	A	1: 135,827,775	L263Q	probably damaging	Het
Lctl	G	A	9: 64,126,967	G296D	probably damaging	Het
Lmtk3	A	T	7: 45,788,000	I205F	possibly damaging	Het
Magel2	G	T	7: 62,379,331	R661L	unknown	Het
Mcm10	G	A	2: 5,007,109	P180S	possibly damaging	Het
Mia3	G	T	1: 183,327,392	A446D		Het
N4bp2	G	A	5: 65,806,371	V588M	probably benign	Het
Naip6	C	T	13: 100,299,751	V755M	probably benign	Het
Neurl1a	T	C	19: 47,240,660	V213A	probably damaging	Het
Nrd1	A	G	4: 109,039,749	T522A	probably damaging	Het
Ntng1	T	C	3: 110,135,447	Q21R	probably damaging	Het
Nup160	T	C	2: 90,703,952	L707S	probably damaging	Het
Oas2	A	T	5: 120,738,522	V452D	probably damaging	Het
Olfr3	A	G	2: 36,812,903	L63P	probably damaging	Het
Olfr350	A	T	2: 36,850,069	M8L	probably benign	Het
Olfr351	G	A	2: 36,859,668	R227*	probably null	Het
Olfr519	A	G	7: 108,894,222	F67L	probably damaging	Het
Olfr593	A	C	7: 103,212,309	T150P	probably damaging	Het
Plekhg1	A	T	10: 3,964,327	T1405S		Het
Pnrc1	G	A	4: 33,248,300	P33L	probably damaging	Het
Prkag2	A	T	5: 24,880,686	V312E	possibly damaging	Het
Rps17	T	A	7: 81,344,345	E76V	possibly damaging	Het
Rsph10b	G	A	5: 143,967,220	G672S	possibly damaging	Het
Slc2a13	T	C	15: 91,321,604	N460S	probably benign	Het
Slco2b1	A	T	7: 99,690,557	C56S	possibly damaging	Het
Spn	T	C	7: 127,137,006	T110A	probably benign	Het
Sult2a8	T	C	7: 14,413,715	N217S	possibly damaging	Het
Tbx2	C	A	11: 85,833,489	T128N	probably damaging	Het
Tecpr2	A	T	12: 110,967,844	M1313L	probably benign	Het
Tmc2	G	A	2: 130,196,577		probably null	Het
Tstd1	G	T	1: 171,419,955	A69S	probably damaging	Het
Txnrd3	A	G	6: 89,661,585	D252G	probably benign	Het
Ulk2	T	C	11: 61,819,348	N345D	probably damaging	Het
Unc13c	T	C	9: 73,574,073	D1694G	probably benign	Het
Vill	T	C	9: 119,065,493	V406A	probably damaging	Het
Vmn2r115	T	C	17: 23,345,913	V258A	possibly damaging	Het
Vmn2r82	T	A	10: 79,396,618	M817K	probably benign	Het
Xpnpep3	T	C	15: 81,430,887	S263P	probably benign	Het
Zfp980	A	G	4: 145,702,144	D481G	probably benign	Het
Zmpste24	A	G	4: 121,095,581	S81P	probably damaging	Het
Znrf4	A	G	17: 56,512,169	V46A	probably benign	Het

Other mutations in Gpr156

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Gpr156	APN	16	37988576	missense	probably damaging	1.00
IGL01615:Gpr156	APN	16	37988591	missense	probably damaging	1.00
IGL01976:Gpr156	APN	16	37979033	missense	probably damaging	0.97
IGL02217:Gpr156	APN	16	38005311	missense	probably benign	0.19
IGL02515:Gpr156	APN	16	38005679	missense	probably damaging	0.97
IGL02596:Gpr156	APN	16	37978724	missense	probably benign	0.00
IGL03068:Gpr156	APN	16	37992129	missense	probably damaging	0.99
R0690:Gpr156	UTSW	16	37992141	missense	probably damaging	1.00
R1034:Gpr156	UTSW	16	38004726	missense	probably benign
R1133:Gpr156	UTSW	16	38005321	missense	probably benign	0.10
R1317:Gpr156	UTSW	16	37987567	missense	probably damaging	1.00
R1437:Gpr156	UTSW	16	37988542	missense	probably damaging	0.99
R1484:Gpr156	UTSW	16	37992196	missense	probably damaging	0.99
R1759:Gpr156	UTSW	16	37948221	missense	probably damaging	0.96
R1761:Gpr156	UTSW	16	37987567	missense	probably damaging	1.00
R1998:Gpr156	UTSW	16	37997908	missense	possibly damaging	0.57
R2067:Gpr156	UTSW	16	37978751	missense	probably benign	0.02
R2111:Gpr156	UTSW	16	37978751	missense	probably benign	0.02
R2509:Gpr156	UTSW	16	37947787	missense	probably benign	0.04
R2872:Gpr156	UTSW	16	37992223	missense	probably damaging	0.99
R2872:Gpr156	UTSW	16	37992223	missense	probably damaging	0.99
R3839:Gpr156	UTSW	16	37988600	missense	probably damaging	0.99
R4492:Gpr156	UTSW	16	37992106	missense	probably damaging	0.99
R4988:Gpr156	UTSW	16	37948215	missense	possibly damaging	0.71
R5329:Gpr156	UTSW	16	38005448	missense	probably benign	0.00
R5361:Gpr156	UTSW	16	38005725	missense	probably damaging	0.99
R5386:Gpr156	UTSW	16	37948309	missense	possibly damaging	0.93
R5531:Gpr156	UTSW	16	38005257	missense	probably benign	0.01
R5886:Gpr156	UTSW	16	37979013	missense	probably damaging	1.00
R5942:Gpr156	UTSW	16	38004902	missense	probably benign	0.04
R6345:Gpr156	UTSW	16	37987519	missense	probably damaging	1.00
R7247:Gpr156	UTSW	16	37947741	missense	probably damaging	1.00
R7954:Gpr156	UTSW	16	37987558	missense	probably damaging	0.97
R8316:Gpr156	UTSW	16	37997974	missense	probably null	0.00
R8333:Gpr156	UTSW	16	37992054	missense	probably damaging	1.00
R8507:Gpr156	UTSW	16	37948236	missense	probably benign
R8770:Gpr156	UTSW	16	38004612	missense	possibly damaging	0.94
R9237:Gpr156	UTSW	16	38005286	nonsense	probably null
R9491:Gpr156	UTSW	16	38005342	missense	probably benign	0.03
R9767:Gpr156	UTSW	16	37997935	missense	probably damaging	1.00
Z1177:Gpr156	UTSW	16	38004863	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- AGTGGTACTACTGTGACCTGTG -3'
(R):5'- AGAACTTTCCTCTTCTAGGCAC -3'

Sequencing Primer
(F):5'- GTGCCTCTGGTCCCTGC -3'
(R):5'- TCTTCTAGGCACCGAGGAG -3'

Posted On

2019-09-13