Incidental Mutation 'R7353:Gpr156'
ID570767
Institutional Source Beutler Lab
Gene Symbol Gpr156
Ensembl Gene ENSMUSG00000046961
Gene NameG protein-coupled receptor 156
SynonymsGababl
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7353 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location37916496-38007530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37992161 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 286 (N286K)
Ref Sequence ENSEMBL: ENSMUSP00000055958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061274]
Predicted Effect probably damaging
Transcript: ENSMUST00000061274
AA Change: N286K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055958
Gene: ENSMUSG00000046961
AA Change: N286K

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:7tm_3 61 313 2.6e-37 PFAM
coiled coil region 353 390 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
low complexity region 681 716 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G protein-coupled receptors (GPCRs) are a large superfamily of cell surface receptors characterized by 7 helical transmembrane domains, together with N-terminal extracellular and C-terminal intracellular domains.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Gpr156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Gpr156 APN 16 37988576 missense probably damaging 1.00
IGL01615:Gpr156 APN 16 37988591 missense probably damaging 1.00
IGL01976:Gpr156 APN 16 37979033 missense probably damaging 0.97
IGL02217:Gpr156 APN 16 38005311 missense probably benign 0.19
IGL02515:Gpr156 APN 16 38005679 missense probably damaging 0.97
IGL02596:Gpr156 APN 16 37978724 missense probably benign 0.00
IGL03068:Gpr156 APN 16 37992129 missense probably damaging 0.99
R0690:Gpr156 UTSW 16 37992141 missense probably damaging 1.00
R1034:Gpr156 UTSW 16 38004726 missense probably benign
R1133:Gpr156 UTSW 16 38005321 missense probably benign 0.10
R1317:Gpr156 UTSW 16 37987567 missense probably damaging 1.00
R1437:Gpr156 UTSW 16 37988542 missense probably damaging 0.99
R1484:Gpr156 UTSW 16 37992196 missense probably damaging 0.99
R1759:Gpr156 UTSW 16 37948221 missense probably damaging 0.96
R1761:Gpr156 UTSW 16 37987567 missense probably damaging 1.00
R1998:Gpr156 UTSW 16 37997908 missense possibly damaging 0.57
R2067:Gpr156 UTSW 16 37978751 missense probably benign 0.02
R2111:Gpr156 UTSW 16 37978751 missense probably benign 0.02
R2509:Gpr156 UTSW 16 37947787 missense probably benign 0.04
R2872:Gpr156 UTSW 16 37992223 missense probably damaging 0.99
R2872:Gpr156 UTSW 16 37992223 missense probably damaging 0.99
R3839:Gpr156 UTSW 16 37988600 missense probably damaging 0.99
R4492:Gpr156 UTSW 16 37992106 missense probably damaging 0.99
R4988:Gpr156 UTSW 16 37948215 missense possibly damaging 0.71
R5329:Gpr156 UTSW 16 38005448 missense probably benign 0.00
R5361:Gpr156 UTSW 16 38005725 missense probably damaging 0.99
R5386:Gpr156 UTSW 16 37948309 missense possibly damaging 0.93
R5531:Gpr156 UTSW 16 38005257 missense probably benign 0.01
R5886:Gpr156 UTSW 16 37979013 missense probably damaging 1.00
R5942:Gpr156 UTSW 16 38004902 missense probably benign 0.04
R6345:Gpr156 UTSW 16 37987519 missense probably damaging 1.00
R7247:Gpr156 UTSW 16 37947741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTACTACTGTGACCTGTG -3'
(R):5'- AGAACTTTCCTCTTCTAGGCAC -3'

Sequencing Primer
(F):5'- GTGCCTCTGGTCCCTGC -3'
(R):5'- TCTTCTAGGCACCGAGGAG -3'
Posted On2019-09-13