Mutagenetix > Incidental Mutation

Incidental Mutation 'R7353:Boc'

570768

Institutional Source

Beutler Lab

Gene Symbol

Boc

Ensembl Gene

ENSMUSG00000022687

Gene Name

biregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7353 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

44485049-44558897 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 44485737 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1070 (V1070M)

Ref Sequence

ENSEMBL: ENSMUSP00000110281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000114634] [ENSMUST00000120049]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000099742

SMART Domains

Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550

Domain	Start	End	E-Value	Type
low complexity region	42	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
Blast:WD40	161	201	1e-7	BLAST
WD40	204	246	4.58e1	SMART
WD40	249	288	4.62e-1	SMART
Blast:WD40	292	337	2e-15	BLAST
WD40	342	381	4.8e-2	SMART
WD40	447	486	4.95e-4	SMART
WD40	491	532	2.64e2	SMART
WD40	552	591	2.98e-7	SMART
Blast:WD40	595	634	1e-19	BLAST
coiled coil region	669	711	N/A	INTRINSIC
WD40	780	820	3.82e1	SMART
WD40	830	872	2.4e-2	SMART
coiled coil region	907	955	N/A	INTRINSIC
coiled coil region	1101	1122	N/A	INTRINSIC
low complexity region	1266	1295	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
coiled coil region	1402	1459	N/A	INTRINSIC
low complexity region	1476	1488	N/A	INTRINSIC
low complexity region	1489	1523	N/A	INTRINSIC
coiled coil region	1543	1607	N/A	INTRINSIC
coiled coil region	1630	1731	N/A	INTRINSIC
coiled coil region	1795	1822	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000114634
AA Change: V1070M

SMART Domains

Protein: ENSMUSP00000110281
Gene: ENSMUSG00000022687
AA Change: V1070M

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IGc2	43	108	4.36e-4	SMART
IG	130	217	8.99e-6	SMART
IGc2	238	301	3.94e-11	SMART
IGc2	330	393	1.46e-14	SMART
low complexity region	423	433	N/A	INTRINSIC
FN3	467	553	1.14e-5	SMART
FN3	601	685	3.53e-11	SMART
FN3	707	794	4.25e-5	SMART
low complexity region	813	829	N/A	INTRINSIC
transmembrane domain	851	873	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120049

SMART Domains

Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550

Domain	Start	End	E-Value	Type
low complexity region	42	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
Blast:WD40	161	201	1e-7	BLAST
WD40	204	246	4.58e1	SMART
WD40	249	288	4.62e-1	SMART
Blast:WD40	292	337	2e-15	BLAST
WD40	342	381	4.8e-2	SMART
WD40	447	486	4.95e-4	SMART
WD40	491	532	2.64e2	SMART
WD40	552	591	2.98e-7	SMART
Blast:WD40	595	634	1e-19	BLAST
coiled coil region	669	711	N/A	INTRINSIC
WD40	780	820	3.82e1	SMART
WD40	830	872	2.4e-2	SMART
coiled coil region	907	955	N/A	INTRINSIC
coiled coil region	1101	1122	N/A	INTRINSIC
low complexity region	1266	1295	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
coiled coil region	1402	1459	N/A	INTRINSIC
low complexity region	1476	1488	N/A	INTRINSIC
low complexity region	1489	1523	N/A	INTRINSIC
coiled coil region	1543	1607	N/A	INTRINSIC
coiled coil region	1630	1731	N/A	INTRINSIC
coiled coil region	1795	1822	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin/fibronectin type III repeat family. It is a component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells, and promotes myogenic differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a null mutation display abnormal commissural axon projections. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110070M22Rik	C	A	13: 119,488,178	A11S	unknown	Het
Aadacl4	G	A	4: 144,617,920	V89I	probably damaging	Het
Abcc9	T	A	6: 142,601,005	I1369F	probably damaging	Het
Adgrf3	T	A	5: 30,198,497	I427F	probably damaging	Het
Alox12e	T	C	11: 70,321,435	Y139C	probably damaging	Het
Arhgef2	T	A	3: 88,635,686	V397E	possibly damaging	Het
Arhgef28	T	A	13: 98,075,202	Y91F	probably damaging	Het
Bcar3	A	G	3: 122,512,692	T454A	probably benign	Het
Bicc1	G	T	10: 70,947,900	T469K	probably benign	Het
Ccdc88a	T	A	11: 29,463,368	N635K	probably benign	Het
Ccr2	T	C	9: 124,106,756	S358P	probably damaging	Het
Ccser2	T	C	14: 36,941,143	Q28R	possibly damaging	Het
Cenpf	T	A	1: 189,654,138	K1982*	probably null	Het
Csn1s2a	A	T	5: 87,785,302	I137F	possibly damaging	Het
Cttnbp2	A	T	6: 18,375,944	I1532K	possibly damaging	Het
Dnajc13	C	A	9: 104,230,031	R304L	possibly damaging	Het
Dopey1	T	A	9: 86,512,859	M664K	probably damaging	Het
Emilin3	T	A	2: 160,908,821	E336V	probably damaging	Het
Eml5	A	G	12: 98,825,424	Y63H		Het
Fbxo41	G	T	6: 85,479,976	R404S	possibly damaging	Het
Gm8897	G	A	5: 11,416,436	D7N	possibly damaging	Het
Gpr155	A	T	2: 73,367,491	Y456*	probably null	Het
Gpr156	T	A	16: 37,992,161	N286K	probably damaging	Het
Kcna5	A	G	6: 126,534,845	S107P	probably benign	Het
Kcne2	A	T	16: 92,296,822	H79L	possibly damaging	Het
Kcnh4	T	A	11: 100,757,199	M113L	probably benign	Het
Lad1	T	A	1: 135,827,775	L263Q	probably damaging	Het
Lctl	G	A	9: 64,126,967	G296D	probably damaging	Het
Lmtk3	A	T	7: 45,788,000	I205F	possibly damaging	Het
Magel2	G	T	7: 62,379,331	R661L	unknown	Het
Mcm10	G	A	2: 5,007,109	P180S	possibly damaging	Het
Mia3	G	T	1: 183,327,392	A446D		Het
N4bp2	G	A	5: 65,806,371	V588M	probably benign	Het
Naip6	C	T	13: 100,299,751	V755M	probably benign	Het
Neurl1a	T	C	19: 47,240,660	V213A	probably damaging	Het
Nrd1	A	G	4: 109,039,749	T522A	probably damaging	Het
Ntng1	T	C	3: 110,135,447	Q21R	probably damaging	Het
Nup160	T	C	2: 90,703,952	L707S	probably damaging	Het
Oas2	A	T	5: 120,738,522	V452D	probably damaging	Het
Olfr3	A	G	2: 36,812,903	L63P	probably damaging	Het
Olfr350	A	T	2: 36,850,069	M8L	probably benign	Het
Olfr351	G	A	2: 36,859,668	R227*	probably null	Het
Olfr519	A	G	7: 108,894,222	F67L	probably damaging	Het
Olfr593	A	C	7: 103,212,309	T150P	probably damaging	Het
Plekhg1	A	T	10: 3,964,327	T1405S		Het
Pnrc1	G	A	4: 33,248,300	P33L	probably damaging	Het
Prkag2	A	T	5: 24,880,686	V312E	possibly damaging	Het
Rps17	T	A	7: 81,344,345	E76V	possibly damaging	Het
Rsph10b	G	A	5: 143,967,220	G672S	possibly damaging	Het
Slc2a13	T	C	15: 91,321,604	N460S	probably benign	Het
Slco2b1	A	T	7: 99,690,557	C56S	possibly damaging	Het
Spn	T	C	7: 127,137,006	T110A	probably benign	Het
Sult2a8	T	C	7: 14,413,715	N217S	possibly damaging	Het
Tbx2	C	A	11: 85,833,489	T128N	probably damaging	Het
Tecpr2	A	T	12: 110,967,844	M1313L	probably benign	Het
Tmc2	G	A	2: 130,196,577		probably null	Het
Tstd1	G	T	1: 171,419,955	A69S	probably damaging	Het
Txnrd3	A	G	6: 89,661,585	D252G	probably benign	Het
Ulk2	T	C	11: 61,819,348	N345D	probably damaging	Het
Unc13c	T	C	9: 73,574,073	D1694G	probably benign	Het
Vill	T	C	9: 119,065,493	V406A	probably damaging	Het
Vmn2r115	T	C	17: 23,345,913	V258A	possibly damaging	Het
Vmn2r82	T	A	10: 79,396,618	M817K	probably benign	Het
Xpnpep3	T	C	15: 81,430,887	S263P	probably benign	Het
Zfp980	A	G	4: 145,702,144	D481G	probably benign	Het
Zmpste24	A	G	4: 121,095,581	S81P	probably damaging	Het
Znrf4	A	G	17: 56,512,169	V46A	probably benign	Het

Other mutations in Boc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:Boc	APN	16	44492955	missense	probably benign	0.00
IGL00981:Boc	APN	16	44491801	missense	probably damaging	0.99
IGL01820:Boc	APN	16	44491872	missense	possibly damaging	0.88
IGL03114:Boc	APN	16	44486752	missense	probably benign	0.38
IGL03195:Boc	APN	16	44492821	missense	probably damaging	0.99
R0006:Boc	UTSW	16	44496449	missense	probably benign	0.41
R0142:Boc	UTSW	16	44490241	missense	probably damaging	1.00
R0417:Boc	UTSW	16	44520234	missense	probably benign	0.16
R1066:Boc	UTSW	16	44490684	critical splice acceptor site	probably null
R1248:Boc	UTSW	16	44520473	missense	probably benign	0.03
R1438:Boc	UTSW	16	44488746	splice site	probably null
R1506:Boc	UTSW	16	44503565	missense	probably damaging	1.00
R1729:Boc	UTSW	16	44496419	missense	probably benign	0.00
R1784:Boc	UTSW	16	44496419	missense	probably benign	0.00
R2004:Boc	UTSW	16	44501644	critical splice donor site	probably null
R2441:Boc	UTSW	16	44488623	missense	probably damaging	1.00
R2863:Boc	UTSW	16	44492960	missense	probably benign	0.03
R3885:Boc	UTSW	16	44487613	splice site	probably benign
R4201:Boc	UTSW	16	44490618	missense	probably damaging	1.00
R4239:Boc	UTSW	16	44491884	missense	probably damaging	1.00
R4382:Boc	UTSW	16	44491182	missense	probably damaging	1.00
R4384:Boc	UTSW	16	44491182	missense	probably damaging	1.00
R4385:Boc	UTSW	16	44491182	missense	probably damaging	1.00
R4684:Boc	UTSW	16	44500380	missense	probably benign	0.07
R4776:Boc	UTSW	16	44487721	missense	probably damaging	0.99
R4788:Boc	UTSW	16	44500433	missense	probably damaging	1.00
R4830:Boc	UTSW	16	44490157	missense	probably damaging	1.00
R5000:Boc	UTSW	16	44490154	missense	probably damaging	1.00
R5567:Boc	UTSW	16	44492824	missense	probably damaging	1.00
R5570:Boc	UTSW	16	44492824	missense	probably damaging	1.00
R5645:Boc	UTSW	16	44499661	missense	probably damaging	0.99
R5651:Boc	UTSW	16	44521195	missense	probably benign	0.00
R5881:Boc	UTSW	16	44490651	missense	probably damaging	1.00
R6021:Boc	UTSW	16	44488654	missense	probably benign	0.00
R6085:Boc	UTSW	16	44488607	missense	probably damaging	1.00
R6188:Boc	UTSW	16	44499548	missense	possibly damaging	0.67
R6295:Boc	UTSW	16	44492348	missense	probably benign	0.05
R6366:Boc	UTSW	16	44487652	missense	probably benign	0.04
R6626:Boc	UTSW	16	44520440	missense	possibly damaging	0.47
R6629:Boc	UTSW	16	44492361	missense	probably benign	0.11
R6707:Boc	UTSW	16	44500616	missense	possibly damaging	0.71
R6819:Boc	UTSW	16	44492825	missense	probably damaging	0.99
R6904:Boc	UTSW	16	44491791	missense	probably damaging	1.00
R7260:Boc	UTSW	16	44490170	missense
R7458:Boc	UTSW	16	44486756	missense
R7671:Boc	UTSW	16	44491849	missense
R8283:Boc	UTSW	16	44520437	missense	noncoding transcript
R8753:Boc	UTSW	16	44500412	missense
R8886:Boc	UTSW	16	44499443	missense
R8906:Boc	UTSW	16	44503568	missense
R9204:Boc	UTSW	16	44487714	missense
R9238:Boc	UTSW	16	44490658	missense
R9400:Boc	UTSW	16	44499481	missense
R9623:Boc	UTSW	16	44501655	missense
R9786:Boc	UTSW	16	44491329	missense
RF028:Boc	UTSW	16	44496433	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GGGAGGATTCCATATCTCTCCAG -3'
(R):5'- ATGCCTTTGGTCCCAACATAG -3'

Sequencing Primer
(F):5'- TTTTCTCTGTCAACAAACAAACAAAC -3'
(R):5'- AGATGAATTGTAAGGGTCCTCC -3'

Posted On

2019-09-13