Incidental Mutation 'R7353:Kcne2'
ID570769
Institutional Source Beutler Lab
Gene Symbol Kcne2
Ensembl Gene ENSMUSG00000039672
Gene Namepotassium voltage-gated channel, Isk-related subfamily, gene 2
SynonymsMiRP1, 2200002I16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7353 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location92292389-92298129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92296822 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 79 (H79L)
Ref Sequence ENSEMBL: ENSMUSP00000048849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047383] [ENSMUST00000063641] [ENSMUST00000113971] [ENSMUST00000118064]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047383
AA Change: H79L

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048849
Gene: ENSMUSG00000039672
AA Change: H79L

DomainStartEndE-ValueType
Pfam:ISK_Channel 9 116 4.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063641
SMART Domains Protein: ENSMUSP00000070724
Gene: ENSMUSG00000051989

DomainStartEndE-ValueType
Pfam:FAM165 4 55 1.6e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113971
AA Change: H79L

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109604
Gene: ENSMUSG00000039672
AA Change: H79L

DomainStartEndE-ValueType
Pfam:ISK_Channel 29 116 1.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118064
SMART Domains Protein: ENSMUSP00000113086
Gene: ENSMUSG00000051989

DomainStartEndE-ValueType
Pfam:FAM165 4 55 1.6e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a small integral membrane subunit that assembles with the KCNH2 gene product, a pore-forming protein, to alter its function. This gene is expressed in heart and muscle and the gene mutations are associated with cardiac arrhythmia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show enlarged stomachs, reduced parietal cell proton secretion, altered parietal cell morphology, achlorhydria, hypergastrinemia, gastric hyperplasia, and increased gastric pH. Males homozygous for a different knock-out allele develop iron-deficient anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Kcne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02703:Kcne2 APN 16 92296950 missense possibly damaging 0.67
R2571:Kcne2 UTSW 16 92296912 missense probably damaging 1.00
R6675:Kcne2 UTSW 16 92296624 missense probably benign 0.00
R8289:Kcne2 UTSW 16 92296819 missense probably damaging 1.00
Z1176:Kcne2 UTSW 16 92296591 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACACTGGAGGATGCCTTC -3'
(R):5'- TCTGAGCAAGCACAAGTGGG -3'

Sequencing Primer
(F):5'- TGGATGCCGAGAACTTCT -3'
(R):5'- AGCAGAAGCACCCTGTCTGAG -3'
Posted On2019-09-13