Incidental Mutation 'R7353:Vmn2r115'
ID 570770
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Name vomeronasal 2, receptor 115
Synonyms V2Rp4, EG638102
MMRRC Submission 045439-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7353 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23562951-23579102 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23564887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 258 (V258A)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
AlphaFold E9Q0E7
Predicted Effect possibly damaging
Transcript: ENSMUST00000168175
AA Change: V258A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: V258A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,624,714 (GRCm39) A11S unknown Het
Aadacl4 G A 4: 144,344,490 (GRCm39) V89I probably damaging Het
Abcc9 T A 6: 142,546,731 (GRCm39) I1369F probably damaging Het
Adgrf3 T A 5: 30,403,495 (GRCm39) I427F probably damaging Het
Alox12e T C 11: 70,212,261 (GRCm39) Y139C probably damaging Het
Arhgef2 T A 3: 88,542,993 (GRCm39) V397E possibly damaging Het
Arhgef28 T A 13: 98,211,710 (GRCm39) Y91F probably damaging Het
Bcar3 A G 3: 122,306,341 (GRCm39) T454A probably benign Het
Bicc1 G T 10: 70,783,730 (GRCm39) T469K probably benign Het
Boc C T 16: 44,306,100 (GRCm39) V1070M unknown Het
Ccdc88a T A 11: 29,413,368 (GRCm39) N635K probably benign Het
Ccr2 T C 9: 123,906,793 (GRCm39) S358P probably damaging Het
Ccser2 T C 14: 36,663,100 (GRCm39) Q28R possibly damaging Het
Cenpf T A 1: 189,386,335 (GRCm39) K1982* probably null Het
Csn1s2a A T 5: 87,933,161 (GRCm39) I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,943 (GRCm39) I1532K possibly damaging Het
Dnajc13 C A 9: 104,107,230 (GRCm39) R304L possibly damaging Het
Dop1a T A 9: 86,394,912 (GRCm39) M664K probably damaging Het
Emilin3 T A 2: 160,750,741 (GRCm39) E336V probably damaging Het
Eml5 A G 12: 98,791,683 (GRCm39) Y63H Het
Fbxo41 G T 6: 85,456,958 (GRCm39) R404S possibly damaging Het
Gpr155 A T 2: 73,197,835 (GRCm39) Y456* probably null Het
Gpr156 T A 16: 37,812,523 (GRCm39) N286K probably damaging Het
Kcna5 A G 6: 126,511,808 (GRCm39) S107P probably benign Het
Kcne2 A T 16: 92,093,710 (GRCm39) H79L possibly damaging Het
Kcnh4 T A 11: 100,648,025 (GRCm39) M113L probably benign Het
Lad1 T A 1: 135,755,513 (GRCm39) L263Q probably damaging Het
Lctl G A 9: 64,034,249 (GRCm39) G296D probably damaging Het
Lmtk3 A T 7: 45,437,424 (GRCm39) I205F possibly damaging Het
Magel2 G T 7: 62,029,079 (GRCm39) R661L unknown Het
Mcm10 G A 2: 5,011,920 (GRCm39) P180S possibly damaging Het
Mia3 G T 1: 183,108,247 (GRCm39) A446D Het
N4bp2 G A 5: 65,963,714 (GRCm39) V588M probably benign Het
Naip6 C T 13: 100,436,259 (GRCm39) V755M probably benign Het
Neurl1a T C 19: 47,229,099 (GRCm39) V213A probably damaging Het
Nrdc A G 4: 108,896,946 (GRCm39) T522A probably damaging Het
Ntng1 T C 3: 110,042,763 (GRCm39) Q21R probably damaging Het
Nup160 T C 2: 90,534,296 (GRCm39) L707S probably damaging Het
Oas2 A T 5: 120,876,587 (GRCm39) V452D probably damaging Het
Or10a3n A G 7: 108,493,429 (GRCm39) F67L probably damaging Het
Or1j1 A G 2: 36,702,915 (GRCm39) L63P probably damaging Het
Or1j4 A T 2: 36,740,081 (GRCm39) M8L probably benign Het
Or1n1 G A 2: 36,749,680 (GRCm39) R227* probably null Het
Or52s1 A C 7: 102,861,516 (GRCm39) T150P probably damaging Het
Plekhg1 A T 10: 3,914,327 (GRCm39) T1405S Het
Pnrc1 G A 4: 33,248,300 (GRCm39) P33L probably damaging Het
Prkag2 A T 5: 25,085,684 (GRCm39) V312E possibly damaging Het
Rps17 T A 7: 80,994,093 (GRCm39) E76V possibly damaging Het
Rsph10b G A 5: 143,904,038 (GRCm39) G672S possibly damaging Het
Slc2a13 T C 15: 91,205,807 (GRCm39) N460S probably benign Het
Slco2b1 A T 7: 99,339,764 (GRCm39) C56S possibly damaging Het
Speer1f G A 5: 11,466,403 (GRCm39) D7N possibly damaging Het
Spn T C 7: 126,736,178 (GRCm39) T110A probably benign Het
Sult2a8 T C 7: 14,147,640 (GRCm39) N217S possibly damaging Het
Tbx2 C A 11: 85,724,315 (GRCm39) T128N probably damaging Het
Tecpr2 A T 12: 110,934,278 (GRCm39) M1313L probably benign Het
Tmc2 G A 2: 130,038,497 (GRCm39) probably null Het
Tstd1 G T 1: 171,247,523 (GRCm39) A69S probably damaging Het
Txnrd3 A G 6: 89,638,567 (GRCm39) D252G probably benign Het
Ulk2 T C 11: 61,710,174 (GRCm39) N345D probably damaging Het
Unc13c T C 9: 73,481,355 (GRCm39) D1694G probably benign Het
Vill T C 9: 118,894,561 (GRCm39) V406A probably damaging Het
Vmn2r82 T A 10: 79,232,452 (GRCm39) M817K probably benign Het
Xpnpep3 T C 15: 81,315,088 (GRCm39) S263P probably benign Het
Zfp980 A G 4: 145,428,714 (GRCm39) D481G probably benign Het
Zmpste24 A G 4: 120,952,778 (GRCm39) S81P probably damaging Het
Znrf4 A G 17: 56,819,169 (GRCm39) V46A probably benign Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23,575,934 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23,565,345 (GRCm39) nonsense probably null
IGL00990:Vmn2r115 APN 17 23,578,371 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23,565,135 (GRCm39) missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23,565,252 (GRCm39) missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23,565,313 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23,578,323 (GRCm39) missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23,565,150 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23,565,180 (GRCm39) missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23,567,008 (GRCm39) nonsense probably null
IGL00990:Vmn2r115 APN 17 23,578,798 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23,578,753 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23,565,238 (GRCm39) missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23,565,346 (GRCm39) missense probably benign 0.30
IGL01073:Vmn2r115 APN 17 23,564,971 (GRCm39) missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23,564,971 (GRCm39) missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23,578,755 (GRCm39) missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23,578,755 (GRCm39) missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23,564,113 (GRCm39) missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23,578,257 (GRCm39) missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23,565,252 (GRCm39) missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23,578,755 (GRCm39) missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23,564,196 (GRCm39) missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23,579,074 (GRCm39) missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23,565,238 (GRCm39) missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23,578,249 (GRCm39) missense probably benign
R0865:Vmn2r115 UTSW 17 23,565,382 (GRCm39) missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1145:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1146:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1207:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1266:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1318:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1367:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1376:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1376:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1420:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1469:Vmn2r115 UTSW 17 23,564,992 (GRCm39) missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23,564,992 (GRCm39) missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23,564,245 (GRCm39) missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23,565,192 (GRCm39) missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23,578,513 (GRCm39) missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1678:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1716:Vmn2r115 UTSW 17 23,566,795 (GRCm39) missense probably benign
R1846:Vmn2r115 UTSW 17 23,578,357 (GRCm39) missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1885:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1887:Vmn2r115 UTSW 17 23,565,007 (GRCm39) missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23,578,388 (GRCm39) missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23,566,927 (GRCm39) missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23,578,297 (GRCm39) missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23,575,998 (GRCm39) missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23,564,146 (GRCm39) missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R3982:Vmn2r115 UTSW 17 23,578,948 (GRCm39) missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23,579,017 (GRCm39) missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23,564,077 (GRCm39) missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23,565,358 (GRCm39) missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23,565,358 (GRCm39) missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23,564,197 (GRCm39) missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23,564,854 (GRCm39) missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23,565,373 (GRCm39) missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23,578,825 (GRCm39) missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23,579,030 (GRCm39) missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23,564,307 (GRCm39) missense probably benign
R5821:Vmn2r115 UTSW 17 23,566,937 (GRCm39) missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23,565,003 (GRCm39) missense probably damaging 1.00
R6193:Vmn2r115 UTSW 17 23,575,983 (GRCm39) missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R6290:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R6319:Vmn2r115 UTSW 17 23,566,877 (GRCm39) missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23,578,572 (GRCm39) missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23,565,006 (GRCm39) missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23,565,046 (GRCm39) missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23,564,989 (GRCm39) missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23,578,785 (GRCm39) missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23,578,576 (GRCm39) missense probably benign 0.01
R7483:Vmn2r115 UTSW 17 23,565,371 (GRCm39) missense possibly damaging 0.95
R7743:Vmn2r115 UTSW 17 23,564,772 (GRCm39) nonsense probably null
R8005:Vmn2r115 UTSW 17 23,563,124 (GRCm39) nonsense probably null
R8191:Vmn2r115 UTSW 17 23,578,530 (GRCm39) missense probably damaging 1.00
R8544:Vmn2r115 UTSW 17 23,564,773 (GRCm39) missense possibly damaging 0.88
R8890:Vmn2r115 UTSW 17 23,578,497 (GRCm39) missense probably damaging 0.98
R9098:Vmn2r115 UTSW 17 23,564,803 (GRCm39) missense probably benign
R9114:Vmn2r115 UTSW 17 23,564,307 (GRCm39) missense probably benign
R9189:Vmn2r115 UTSW 17 23,564,784 (GRCm39) missense probably damaging 1.00
R9351:Vmn2r115 UTSW 17 23,578,482 (GRCm39) missense probably benign 0.05
R9397:Vmn2r115 UTSW 17 23,564,152 (GRCm39) nonsense probably null
R9410:Vmn2r115 UTSW 17 23,578,915 (GRCm39) missense possibly damaging 0.67
R9593:Vmn2r115 UTSW 17 23,578,184 (GRCm39) missense probably damaging 0.99
V5622:Vmn2r115 UTSW 17 23,578,333 (GRCm39) missense probably benign
V5622:Vmn2r115 UTSW 17 23,565,201 (GRCm39) missense probably damaging 1.00
X0023:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
X0033:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACCATACATCTCTAGCCTTTGG -3'
(R):5'- GTTGTCCAAAAGCAAAAGTCCC -3'

Sequencing Primer
(F):5'- TGGCCTGGTATCCTTCATAATTC -3'
(R):5'- TGTCCAAAAGCAAAAGTCCCATATTC -3'
Posted On 2019-09-13