Incidental Mutation 'R7354:Olfr1294'
ID570780
Institutional Source Beutler Lab
Gene Symbol Olfr1294
Ensembl Gene ENSMUSG00000109547
Gene Nameolfactory receptor 1294
SynonymsGA_x6K02T2Q125-72589785-72588847, MOR248-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R7354 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111536530-111540291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111537564 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 242 (A242T)
Ref Sequence ENSEMBL: ENSMUSP00000146438 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208334
AA Change: A242T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208675
AA Change: A242T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000215245
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,741,834 L724* probably null Het
5430419D17Rik G T 7: 131,272,033 C1696F unknown Het
5430419D17Rik G A 7: 131,256,729 C1042Y possibly damaging Het
Ago3 T A 4: 126,417,306 Q38L possibly damaging Het
Apon T A 10: 128,254,738 I95N probably benign Het
Arid1a G T 4: 133,693,947 P464Q unknown Het
Arid4b A G 13: 14,164,870 D503G probably benign Het
Asxl2 T C 12: 3,455,637 probably benign Het
Atp2a1 A T 7: 126,448,856 V594D probably damaging Het
Begain A G 12: 109,033,289 F519L possibly damaging Het
Bora A G 14: 99,047,358 T15A probably damaging Het
Btbd7 A T 12: 102,838,205 M192K probably benign Het
Ccdc125 T G 13: 100,677,874 probably null Het
Cfap74 G T 4: 155,465,347 V146L unknown Het
Crisp1 G A 17: 40,319,180 probably benign Het
Ctbp1 A T 5: 33,250,388 H292Q possibly damaging Het
Defb5 T A 8: 19,250,734 M34K probably benign Het
Dnajc27 A G 12: 4,096,249 I93V probably benign Het
Dqx1 T A 6: 83,060,976 Y448* probably null Het
Dynap A T 18: 70,241,300 C52S possibly damaging Het
Ehd4 C A 2: 120,102,132 R271L probably damaging Het
Ercc2 T G 7: 19,393,654 I619S possibly damaging Het
Etf1 A G 18: 34,905,987 I409T probably damaging Het
Fam117a A G 11: 95,380,703 D367G probably damaging Het
Fancd2 A G 6: 113,595,946 D1447G unknown Het
Fbxw9 T C 8: 85,062,196 S192P probably damaging Het
Frzb A T 2: 80,446,809 L11Q probably damaging Het
Gm14496 T C 2: 182,000,686 S717P probably damaging Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gm4353 C T 7: 116,083,911 R145Q probably benign Het
Gm765 T A 6: 98,238,281 D127V probably damaging Het
Gpr12 A T 5: 146,583,962 V50D probably damaging Het
Hes1 T C 16: 30,065,928 probably null Het
Hmcn1 A T 1: 150,806,445 C451* probably null Het
Iars T C 13: 49,704,320 V347A probably benign Het
Igfn1 A G 1: 135,976,032 S323P possibly damaging Het
Itga6 G A 2: 71,820,230 A207T probably damaging Het
Lgi4 T A 7: 31,060,622 L81H probably damaging Het
Lrp1 T C 10: 127,571,408 E1888G probably damaging Het
Man2a1 C T 17: 64,752,544 T1142M probably damaging Het
Mgam A T 6: 40,744,798 Y350F probably damaging Het
Miga1 T C 3: 152,290,500 D351G probably damaging Het
Mro A G 18: 73,873,314 T111A probably benign Het
Mtrr A T 13: 68,566,207 V471E probably damaging Het
Myh3 C A 11: 67,096,882 L1394I probably damaging Het
Myocd A G 11: 65,187,493 V492A probably benign Het
Nbeal2 A G 9: 110,629,179 F2115S probably damaging Het
Nlrp1b A T 11: 71,181,550 M489K possibly damaging Het
Olfr1228 T C 2: 89,248,687 probably null Het
Olfr128 A G 17: 37,924,393 I276V probably benign Het
Olfr376 A T 11: 73,375,375 I212F probably benign Het
Olfr536 A C 7: 140,504,186 I91R probably damaging Het
Orc2 A G 1: 58,469,747 S462P possibly damaging Het
Pcdh9 T C 14: 93,888,270 T155A probably benign Het
Pcdhb16 G A 18: 37,478,124 V46I possibly damaging Het
Pcdhb22 A G 18: 37,520,258 D336G probably damaging Het
Pde4dip T A 3: 97,719,330 R1297S probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Plxnb2 A G 15: 89,165,725 M531T possibly damaging Het
Poc5 T C 13: 96,394,525 V77A probably benign Het
Recql5 G A 11: 115,928,201 R180C probably damaging Het
Rho C A 6: 115,935,503 Y268* probably null Het
Riok1 A T 13: 38,047,312 H182L probably benign Het
Rnf207 T C 4: 152,314,091 D273G probably damaging Het
Serpinb11 A G 1: 107,377,533 Y213C probably benign Het
Slc16a10 T C 10: 40,076,955 Y181C probably damaging Het
Slc22a15 G A 3: 101,864,581 H401Y probably benign Het
Slc5a5 C A 8: 70,889,603 R268L probably damaging Het
Slc9a8 T C 2: 167,474,131 F576S possibly damaging Het
Slx4 T C 16: 3,987,099 E617G probably benign Het
Top1 T C 2: 160,704,958 I386T probably damaging Het
Tor1aip1 G T 1: 156,036,113 D41E probably damaging Het
Tsc22d4 G A 5: 137,768,109 R479Q probably benign Het
Unc79 C T 12: 103,142,702 T2191I possibly damaging Het
Vmn2r109 A T 17: 20,540,781 D771E probably damaging Het
Vmn2r82 A C 10: 79,356,630 M14L probably benign Het
Zc3h7a C T 16: 11,148,514 S583N probably damaging Het
Zfp518b G A 5: 38,682,779 probably benign Het
Zswim4 A G 8: 84,228,849 W314R probably damaging Het
Other mutations in Olfr1294
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Olfr1294 APN 2 111538014 missense probably damaging 1.00
IGL02304:Olfr1294 APN 2 111537401 missense probably benign 0.06
IGL02555:Olfr1294 APN 2 111537917 missense probably damaging 0.98
R0422:Olfr1294 UTSW 2 111537983 missense probably damaging 0.97
R0647:Olfr1294 UTSW 2 111537359 missense probably benign 0.00
R0656:Olfr1294 UTSW 2 111537627 missense probably damaging 1.00
R1543:Olfr1294 UTSW 2 111537797 missense probably benign 0.00
R1909:Olfr1294 UTSW 2 111538014 missense probably damaging 1.00
R3735:Olfr1294 UTSW 2 111537896 missense probably damaging 1.00
R4671:Olfr1294 UTSW 2 111537935 missense probably damaging 1.00
R4703:Olfr1294 UTSW 2 111537768 missense probably benign 0.03
R4809:Olfr1294 UTSW 2 111537611 missense probably benign 0.15
R4822:Olfr1294 UTSW 2 111537452 missense probably damaging 0.98
R4837:Olfr1294 UTSW 2 111537974 missense probably damaging 0.98
R4880:Olfr1294 UTSW 2 111537353 nonsense probably null
R5203:Olfr1294 UTSW 2 111537636 missense probably damaging 1.00
R5871:Olfr1294 UTSW 2 111537639 missense probably damaging 1.00
R5902:Olfr1294 UTSW 2 111537394 missense probably benign 0.00
R6501:Olfr1294 UTSW 2 111537779 missense probably damaging 1.00
R7575:Olfr1294 UTSW 2 111538252 missense probably damaging 1.00
R7623:Olfr1294 UTSW 2 111537936 missense probably damaging 1.00
R7632:Olfr1294 UTSW 2 111538176 missense possibly damaging 0.87
R7845:Olfr1294 UTSW 2 111538167 nonsense probably null
R8130:Olfr1294 UTSW 2 111537480 missense probably damaging 1.00
Z1088:Olfr1294 UTSW 2 111537814 missense possibly damaging 0.89
Z1176:Olfr1294 UTSW 2 111538285 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- TACTTTGGGACCCAGAAAGTTGC -3'
(R):5'- CTTCTGTGACATGCCACTGG -3'

Sequencing Primer
(F):5'- TTGGGACCCAGAAAGTTGCCTATG -3'
(R):5'- GCCACTGGTAATAAAACTTGCATGC -3'
Posted On2019-09-13