Incidental Mutation 'R7354:Zfp518b'
ID570793
Institutional Source Beutler Lab
Gene Symbol Zfp518b
Ensembl Gene ENSMUSG00000046572
Gene Namezinc finger protein 518B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7354 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location38668484-38684826 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 38682779 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057258] [ENSMUST00000178760] [ENSMUST00000179555] [ENSMUST00000180214]
Predicted Effect probably benign
Transcript: ENSMUST00000057258
SMART Domains Protein: ENSMUSP00000061753
Gene: ENSMUSG00000046572

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
ZnF_C2H2 165 187 1.67e-2 SMART
ZnF_C2H2 193 216 1.16e-1 SMART
low complexity region 523 536 N/A INTRINSIC
low complexity region 636 645 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 1011 1023 N/A INTRINSIC
ZnF_C2H2 1044 1066 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178760
Predicted Effect probably benign
Transcript: ENSMUST00000179555
SMART Domains Protein: ENSMUSP00000137381
Gene: ENSMUSG00000046572

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
ZnF_C2H2 165 187 1.67e-2 SMART
ZnF_C2H2 193 216 1.16e-1 SMART
low complexity region 523 536 N/A INTRINSIC
low complexity region 636 645 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 1011 1023 N/A INTRINSIC
ZnF_C2H2 1044 1066 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180214
SMART Domains Protein: ENSMUSP00000136948
Gene: ENSMUSG00000046572

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,741,834 L724* probably null Het
5430419D17Rik G T 7: 131,272,033 C1696F unknown Het
5430419D17Rik G A 7: 131,256,729 C1042Y possibly damaging Het
Ago3 T A 4: 126,417,306 Q38L possibly damaging Het
Apon T A 10: 128,254,738 I95N probably benign Het
Arid1a G T 4: 133,693,947 P464Q unknown Het
Arid4b A G 13: 14,164,870 D503G probably benign Het
Asxl2 T C 12: 3,455,637 probably benign Het
Atp2a1 A T 7: 126,448,856 V594D probably damaging Het
Begain A G 12: 109,033,289 F519L possibly damaging Het
Bora A G 14: 99,047,358 T15A probably damaging Het
Btbd7 A T 12: 102,838,205 M192K probably benign Het
Ccdc125 T G 13: 100,677,874 probably null Het
Cfap74 G T 4: 155,465,347 V146L unknown Het
Crisp1 G A 17: 40,319,180 probably benign Het
Ctbp1 A T 5: 33,250,388 H292Q possibly damaging Het
Defb5 T A 8: 19,250,734 M34K probably benign Het
Dnajc27 A G 12: 4,096,249 I93V probably benign Het
Dqx1 T A 6: 83,060,976 Y448* probably null Het
Dynap A T 18: 70,241,300 C52S possibly damaging Het
Ehd4 C A 2: 120,102,132 R271L probably damaging Het
Ercc2 T G 7: 19,393,654 I619S possibly damaging Het
Etf1 A G 18: 34,905,987 I409T probably damaging Het
Fam117a A G 11: 95,380,703 D367G probably damaging Het
Fancd2 A G 6: 113,595,946 D1447G unknown Het
Fbxw9 T C 8: 85,062,196 S192P probably damaging Het
Frzb A T 2: 80,446,809 L11Q probably damaging Het
Gm14496 T C 2: 182,000,686 S717P probably damaging Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gm4353 C T 7: 116,083,911 R145Q probably benign Het
Gm765 T A 6: 98,238,281 D127V probably damaging Het
Gpr12 A T 5: 146,583,962 V50D probably damaging Het
Hes1 T C 16: 30,065,928 probably null Het
Hmcn1 A T 1: 150,806,445 C451* probably null Het
Iars T C 13: 49,704,320 V347A probably benign Het
Igfn1 A G 1: 135,976,032 S323P possibly damaging Het
Itga6 G A 2: 71,820,230 A207T probably damaging Het
Lgi4 T A 7: 31,060,622 L81H probably damaging Het
Lrp1 T C 10: 127,571,408 E1888G probably damaging Het
Man2a1 C T 17: 64,752,544 T1142M probably damaging Het
Mgam A T 6: 40,744,798 Y350F probably damaging Het
Miga1 T C 3: 152,290,500 D351G probably damaging Het
Mro A G 18: 73,873,314 T111A probably benign Het
Mtrr A T 13: 68,566,207 V471E probably damaging Het
Myh3 C A 11: 67,096,882 L1394I probably damaging Het
Myocd A G 11: 65,187,493 V492A probably benign Het
Nbeal2 A G 9: 110,629,179 F2115S probably damaging Het
Nlrp1b A T 11: 71,181,550 M489K possibly damaging Het
Olfr1228 T C 2: 89,248,687 probably null Het
Olfr128 A G 17: 37,924,393 I276V probably benign Het
Olfr1294 C T 2: 111,537,564 A242T possibly damaging Het
Olfr376 A T 11: 73,375,375 I212F probably benign Het
Olfr536 A C 7: 140,504,186 I91R probably damaging Het
Orc2 A G 1: 58,469,747 S462P possibly damaging Het
Pcdh9 T C 14: 93,888,270 T155A probably benign Het
Pcdhb16 G A 18: 37,478,124 V46I possibly damaging Het
Pcdhb22 A G 18: 37,520,258 D336G probably damaging Het
Pde4dip T A 3: 97,719,330 R1297S probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Plxnb2 A G 15: 89,165,725 M531T possibly damaging Het
Poc5 T C 13: 96,394,525 V77A probably benign Het
Recql5 G A 11: 115,928,201 R180C probably damaging Het
Rho C A 6: 115,935,503 Y268* probably null Het
Riok1 A T 13: 38,047,312 H182L probably benign Het
Rnf207 T C 4: 152,314,091 D273G probably damaging Het
Serpinb11 A G 1: 107,377,533 Y213C probably benign Het
Slc16a10 T C 10: 40,076,955 Y181C probably damaging Het
Slc22a15 G A 3: 101,864,581 H401Y probably benign Het
Slc5a5 C A 8: 70,889,603 R268L probably damaging Het
Slc9a8 T C 2: 167,474,131 F576S possibly damaging Het
Slx4 T C 16: 3,987,099 E617G probably benign Het
Top1 T C 2: 160,704,958 I386T probably damaging Het
Tor1aip1 G T 1: 156,036,113 D41E probably damaging Het
Tsc22d4 G A 5: 137,768,109 R479Q probably benign Het
Unc79 C T 12: 103,142,702 T2191I possibly damaging Het
Vmn2r109 A T 17: 20,540,781 D771E probably damaging Het
Vmn2r82 A C 10: 79,356,630 M14L probably benign Het
Zc3h7a C T 16: 11,148,514 S583N probably damaging Het
Zswim4 A G 8: 84,228,849 W314R probably damaging Het
Other mutations in Zfp518b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfp518b APN 5 38673766 missense possibly damaging 0.58
IGL01096:Zfp518b APN 5 38672788 missense probably benign 0.01
IGL02150:Zfp518b APN 5 38673343 missense probably damaging 1.00
IGL02150:Zfp518b APN 5 38673789 missense probably damaging 1.00
IGL02491:Zfp518b APN 5 38673780 missense possibly damaging 0.90
IGL02643:Zfp518b APN 5 38674155 missense probably damaging 1.00
IGL02710:Zfp518b APN 5 38672718 missense probably damaging 1.00
R0134:Zfp518b UTSW 5 38674659 start codon destroyed probably null 0.92
R0284:Zfp518b UTSW 5 38671740 missense probably damaging 1.00
R0308:Zfp518b UTSW 5 38672770 missense possibly damaging 0.64
R0421:Zfp518b UTSW 5 38674575 missense probably damaging 1.00
R0613:Zfp518b UTSW 5 38673603 missense probably damaging 1.00
R1604:Zfp518b UTSW 5 38673606 missense probably damaging 1.00
R1649:Zfp518b UTSW 5 38671881 missense probably damaging 1.00
R1845:Zfp518b UTSW 5 38671741 missense probably damaging 0.97
R1853:Zfp518b UTSW 5 38673407 missense probably benign 0.00
R2015:Zfp518b UTSW 5 38672002 missense probably benign 0.00
R2256:Zfp518b UTSW 5 38671636 missense possibly damaging 0.90
R3687:Zfp518b UTSW 5 38674112 missense probably damaging 1.00
R4275:Zfp518b UTSW 5 38671728 missense probably damaging 1.00
R4600:Zfp518b UTSW 5 38673627 missense probably damaging 0.98
R4603:Zfp518b UTSW 5 38673627 missense probably damaging 0.98
R4739:Zfp518b UTSW 5 38674498 missense possibly damaging 0.89
R5519:Zfp518b UTSW 5 38674098 missense probably damaging 1.00
R6827:Zfp518b UTSW 5 38671539 missense probably damaging 1.00
R6982:Zfp518b UTSW 5 38672905 missense probably benign 0.00
R7263:Zfp518b UTSW 5 38672328 missense probably damaging 1.00
R7271:Zfp518b UTSW 5 38674564 missense probably benign 0.01
R7554:Zfp518b UTSW 5 38673072 missense probably damaging 1.00
R7738:Zfp518b UTSW 5 38672187 missense probably benign 0.20
R7817:Zfp518b UTSW 5 38672398 missense not run
R8166:Zfp518b UTSW 5 38674495 missense probably damaging 0.99
R8505:Zfp518b UTSW 5 38672776 missense probably benign
Z1088:Zfp518b UTSW 5 38674293 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAGCAGAGGTTACAGCCAG -3'
(R):5'- TTCTGAATCAGCCGTGAGCC -3'

Sequencing Primer
(F):5'- CAGAGGTTACAGCCAGGATTCC -3'
(R):5'- TCCAGCAAGGAAGCCCTC -3'
Posted On2019-09-13