Incidental Mutation 'R7354:Rho'
ID570800
Institutional Source Beutler Lab
Gene Symbol Rho
Ensembl Gene ENSMUSG00000030324
Gene Namerhodopsin
SynonymsNoerg1, Ops, RP4, Long Wavelength Sensitive opsin, opsin 2, L opsin, LWS opsin, Red Opsin, Opn2, Rod Opsin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R7354 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location115931748-115940036 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 115935503 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 268 (Y268*)
Ref Sequence ENSEMBL: ENSMUSP00000032471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032471] [ENSMUST00000203877] [ENSMUST00000204493] [ENSMUST00000204711]
Predicted Effect probably null
Transcript: ENSMUST00000032471
AA Change: Y268*
SMART Domains Protein: ENSMUSP00000032471
Gene: ENSMUSG00000030324
AA Change: Y268*

DomainStartEndE-ValueType
Pfam:Rhodopsin_N 2 37 1e-23 PFAM
Pfam:7TM_GPCR_Srv 40 323 1.2e-12 PFAM
Pfam:7TM_GPCR_Srw 42 324 7.9e-12 PFAM
Pfam:7TM_GPCR_Srsx 48 321 4.9e-11 PFAM
Pfam:7tm_1 54 306 5.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203877
AA Change: Y109*
SMART Domains Protein: ENSMUSP00000144952
Gene: ENSMUSG00000030324
AA Change: Y109*

DomainStartEndE-ValueType
Pfam:7tm_1 6 147 1.6e-17 PFAM
Pfam:7TM_GPCR_Srw 19 165 1.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 25 162 1.2e-4 PFAM
Pfam:7TM_GPCR_Srv 29 164 7.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204493
SMART Domains Protein: ENSMUSP00000145464
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
low complexity region 20 41 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204711
AA Change: Y126*
SMART Domains Protein: ENSMUSP00000144768
Gene: ENSMUSG00000030324
AA Change: Y126*

DomainStartEndE-ValueType
Pfam:7tm_1 1 164 4.1e-24 PFAM
Pfam:7TM_GPCR_Srw 11 182 5.4e-9 PFAM
Pfam:7TM_GPCR_Srv 13 181 1.6e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinitis pigmentosa is an inherited progressive disease which is a major cause of blindness in western communities. It can be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive disorder. In the autosomal dominant form,which comprises about 25% of total cases, approximately 30% of families have mutations in the gene encoding the rod photoreceptor-specific protein rhodopsin. This is the transmembrane protein which, when photoexcited, initiates the visual transduction cascade. Defects in this gene are also one of the causes of congenital stationary night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null homozygotes fail to develop retinal rod outer segments and lose their photoreceptors while heterozygotes exhibit some disorganization of their photoreceptors and a shortening of the outer segments with age. Some point mutants have only light-induced photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,741,834 L724* probably null Het
5430419D17Rik G A 7: 131,256,729 C1042Y possibly damaging Het
5430419D17Rik G T 7: 131,272,033 C1696F unknown Het
Ago3 T A 4: 126,417,306 Q38L possibly damaging Het
Apon T A 10: 128,254,738 I95N probably benign Het
Arid1a G T 4: 133,693,947 P464Q unknown Het
Arid4b A G 13: 14,164,870 D503G probably benign Het
Asxl2 T C 12: 3,455,637 probably benign Het
Atp2a1 A T 7: 126,448,856 V594D probably damaging Het
Begain A G 12: 109,033,289 F519L possibly damaging Het
Bora A G 14: 99,047,358 T15A probably damaging Het
Btbd7 A T 12: 102,838,205 M192K probably benign Het
Ccdc125 T G 13: 100,677,874 probably null Het
Cfap74 G T 4: 155,465,347 V146L unknown Het
Crisp1 G A 17: 40,319,180 probably benign Het
Ctbp1 A T 5: 33,250,388 H292Q possibly damaging Het
Defb5 T A 8: 19,250,734 M34K probably benign Het
Dnajc27 A G 12: 4,096,249 I93V probably benign Het
Dqx1 T A 6: 83,060,976 Y448* probably null Het
Dynap A T 18: 70,241,300 C52S possibly damaging Het
Ehd4 C A 2: 120,102,132 R271L probably damaging Het
Ercc2 T G 7: 19,393,654 I619S possibly damaging Het
Etf1 A G 18: 34,905,987 I409T probably damaging Het
Fam117a A G 11: 95,380,703 D367G probably damaging Het
Fancd2 A G 6: 113,595,946 D1447G unknown Het
Fbxw9 T C 8: 85,062,196 S192P probably damaging Het
Frzb A T 2: 80,446,809 L11Q probably damaging Het
Gm14496 T C 2: 182,000,686 S717P probably damaging Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gm4353 C T 7: 116,083,911 R145Q probably benign Het
Gm765 T A 6: 98,238,281 D127V probably damaging Het
Gpr12 A T 5: 146,583,962 V50D probably damaging Het
Hes1 T C 16: 30,065,928 probably null Het
Hmcn1 A T 1: 150,806,445 C451* probably null Het
Iars T C 13: 49,704,320 V347A probably benign Het
Igfn1 A G 1: 135,976,032 S323P possibly damaging Het
Itga6 G A 2: 71,820,230 A207T probably damaging Het
Lgi4 T A 7: 31,060,622 L81H probably damaging Het
Lrp1 T C 10: 127,571,408 E1888G probably damaging Het
Man2a1 C T 17: 64,752,544 T1142M probably damaging Het
Mgam A T 6: 40,744,798 Y350F probably damaging Het
Miga1 T C 3: 152,290,500 D351G probably damaging Het
Mro A G 18: 73,873,314 T111A probably benign Het
Mtrr A T 13: 68,566,207 V471E probably damaging Het
Myh3 C A 11: 67,096,882 L1394I probably damaging Het
Myocd A G 11: 65,187,493 V492A probably benign Het
Nbeal2 A G 9: 110,629,179 F2115S probably damaging Het
Nlrp1b A T 11: 71,181,550 M489K possibly damaging Het
Olfr1228 T C 2: 89,248,687 probably null Het
Olfr128 A G 17: 37,924,393 I276V probably benign Het
Olfr1294 C T 2: 111,537,564 A242T possibly damaging Het
Olfr376 A T 11: 73,375,375 I212F probably benign Het
Olfr536 A C 7: 140,504,186 I91R probably damaging Het
Orc2 A G 1: 58,469,747 S462P possibly damaging Het
Pcdh9 T C 14: 93,888,270 T155A probably benign Het
Pcdhb16 G A 18: 37,478,124 V46I possibly damaging Het
Pcdhb22 A G 18: 37,520,258 D336G probably damaging Het
Pde4dip T A 3: 97,719,330 R1297S probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Plxnb2 A G 15: 89,165,725 M531T possibly damaging Het
Poc5 T C 13: 96,394,525 V77A probably benign Het
Recql5 G A 11: 115,928,201 R180C probably damaging Het
Riok1 A T 13: 38,047,312 H182L probably benign Het
Rnf207 T C 4: 152,314,091 D273G probably damaging Het
Serpinb11 A G 1: 107,377,533 Y213C probably benign Het
Slc16a10 T C 10: 40,076,955 Y181C probably damaging Het
Slc22a15 G A 3: 101,864,581 H401Y probably benign Het
Slc5a5 C A 8: 70,889,603 R268L probably damaging Het
Slc9a8 T C 2: 167,474,131 F576S possibly damaging Het
Slx4 T C 16: 3,987,099 E617G probably benign Het
Top1 T C 2: 160,704,958 I386T probably damaging Het
Tor1aip1 G T 1: 156,036,113 D41E probably damaging Het
Tsc22d4 G A 5: 137,768,109 R479Q probably benign Het
Unc79 C T 12: 103,142,702 T2191I possibly damaging Het
Vmn2r109 A T 17: 20,540,781 D771E probably damaging Het
Vmn2r82 A C 10: 79,356,630 M14L probably benign Het
Zc3h7a C T 16: 11,148,514 S583N probably damaging Het
Zfp518b G A 5: 38,682,779 probably benign Het
Zswim4 A G 8: 84,228,849 W314R probably damaging Het
Other mutations in Rho
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Rho APN 6 115932185 missense probably damaging 0.99
IGL02480:Rho APN 6 115935544 missense probably benign 0.20
IGL02625:Rho APN 6 115935197 missense possibly damaging 0.95
bemr3 UTSW 6 115935131 missense probably damaging 1.00
R0165:Rho UTSW 6 115932227 missense probably damaging 1.00
R1167:Rho UTSW 6 115935423 missense probably damaging 0.98
R1169:Rho UTSW 6 115932238 missense probably damaging 1.00
R1312:Rho UTSW 6 115935605 missense probably damaging 1.00
R2393:Rho UTSW 6 115935391 splice site probably benign
R3895:Rho UTSW 6 115933902 missense probably damaging 1.00
R4414:Rho UTSW 6 115935230 missense probably benign
R4416:Rho UTSW 6 115935230 missense probably benign
R5753:Rho UTSW 6 115935487 missense probably damaging 1.00
R6483:Rho UTSW 6 115932257 missense possibly damaging 0.78
R6552:Rho UTSW 6 115931748 unclassified probably null
R6719:Rho UTSW 6 115933893 missense possibly damaging 0.58
R7030:Rho UTSW 6 115935543 missense possibly damaging 0.93
R7566:Rho UTSW 6 115932174 missense probably damaging 1.00
R7674:Rho UTSW 6 115932333 missense probably damaging 1.00
R7699:Rho UTSW 6 115935239 missense probably damaging 0.98
R7700:Rho UTSW 6 115935239 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATCGTCATCTTCTTCTGCTATGGG -3'
(R):5'- CCAGCAGTCTGAGTGCAATG -3'

Sequencing Primer
(F):5'- AGCTGGTCTTCACAGTCAAG -3'
(R):5'- AGTCTGAGTGCAATGCCTCC -3'
Posted On2019-09-13