Incidental Mutation 'R7354:Pcdh9'
ID570835
Institutional Source Beutler Lab
Gene Symbol Pcdh9
Ensembl Gene ENSMUSG00000055421
Gene Nameprotocadherin 9
SynonymsC630029H24Rik, A730003J17Rik, C530050I23Rik, LOC382930, 1500001L12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R7354 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location93013410-93890679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93888270 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 155 (T155A)
Ref Sequence ENSEMBL: ENSMUSP00000070935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068992] [ENSMUST00000192221] [ENSMUST00000193901] [ENSMUST00000194056] [ENSMUST00000195376] [ENSMUST00000195826]
Predicted Effect probably benign
Transcript: ENSMUST00000068992
AA Change: T155A

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070935
Gene: ENSMUSG00000055421
AA Change: T155A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192221
AA Change: T32A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142260
Gene: ENSMUSG00000055421
AA Change: T32A

DomainStartEndE-ValueType
CA 41 127 1.01e-20 SMART
CA 151 233 2.34e-25 SMART
CA 263 344 2.14e-19 SMART
CA 368 447 4.27e-28 SMART
CA 471 550 2.45e-28 SMART
CA 577 659 1.01e-6 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 735 760 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193901
AA Change: T155A

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141759
Gene: ENSMUSG00000055421
AA Change: T155A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194056
AA Change: T155A

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141602
Gene: ENSMUSG00000055421
AA Change: T155A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194129
Predicted Effect possibly damaging
Transcript: ENSMUST00000195376
AA Change: T155A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142224
Gene: ENSMUSG00000055421
AA Change: T155A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 4.1e-5 SMART
CA 164 250 4.8e-23 SMART
CA 274 356 1.2e-27 SMART
CA 386 467 1.1e-21 SMART
CA 491 570 2e-30 SMART
CA 594 673 1.2e-30 SMART
CA 700 782 4.9e-9 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195826
AA Change: T155A

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141396
Gene: ENSMUSG00000055421
AA Change: T155A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 49 140 8.37e-3 SMART
CA 164 250 1.01e-20 SMART
CA 274 356 2.34e-25 SMART
CA 386 467 2.14e-19 SMART
CA 491 570 4.27e-28 SMART
CA 594 673 2.45e-28 SMART
CA 700 782 1.01e-6 SMART
transmembrane domain 814 836 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: This gene encodes a member of the protocadherin family, and cadherin superfamily, of transmembrane proteins containing cadherin domains. These proteins mediate cell adhesion in neural tissues in the presence of calcium. The encoded protein may be involved in signaling at neuronal synaptic junctions. Sharing a characteristic with other protocadherin genes, this gene has a notably large exon that encodes multiple cadherin domains and a transmembrane region. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired long-term social and bject recognition and sensorimotor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,741,834 L724* probably null Het
5430419D17Rik G A 7: 131,256,729 C1042Y possibly damaging Het
5430419D17Rik G T 7: 131,272,033 C1696F unknown Het
Ago3 T A 4: 126,417,306 Q38L possibly damaging Het
Apon T A 10: 128,254,738 I95N probably benign Het
Arid1a G T 4: 133,693,947 P464Q unknown Het
Arid4b A G 13: 14,164,870 D503G probably benign Het
Asxl2 T C 12: 3,455,637 probably benign Het
Atp2a1 A T 7: 126,448,856 V594D probably damaging Het
Begain A G 12: 109,033,289 F519L possibly damaging Het
Bora A G 14: 99,047,358 T15A probably damaging Het
Btbd7 A T 12: 102,838,205 M192K probably benign Het
Ccdc125 T G 13: 100,677,874 probably null Het
Cfap74 G T 4: 155,465,347 V146L unknown Het
Crisp1 G A 17: 40,319,180 probably benign Het
Ctbp1 A T 5: 33,250,388 H292Q possibly damaging Het
Defb5 T A 8: 19,250,734 M34K probably benign Het
Dnajc27 A G 12: 4,096,249 I93V probably benign Het
Dqx1 T A 6: 83,060,976 Y448* probably null Het
Dynap A T 18: 70,241,300 C52S possibly damaging Het
Ehd4 C A 2: 120,102,132 R271L probably damaging Het
Ercc2 T G 7: 19,393,654 I619S possibly damaging Het
Etf1 A G 18: 34,905,987 I409T probably damaging Het
Fam117a A G 11: 95,380,703 D367G probably damaging Het
Fancd2 A G 6: 113,595,946 D1447G unknown Het
Fbxw9 T C 8: 85,062,196 S192P probably damaging Het
Frzb A T 2: 80,446,809 L11Q probably damaging Het
Gm14496 T C 2: 182,000,686 S717P probably damaging Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gm4353 C T 7: 116,083,911 R145Q probably benign Het
Gm765 T A 6: 98,238,281 D127V probably damaging Het
Gpr12 A T 5: 146,583,962 V50D probably damaging Het
Hes1 T C 16: 30,065,928 probably null Het
Hmcn1 A T 1: 150,806,445 C451* probably null Het
Iars T C 13: 49,704,320 V347A probably benign Het
Igfn1 A G 1: 135,976,032 S323P possibly damaging Het
Itga6 G A 2: 71,820,230 A207T probably damaging Het
Lgi4 T A 7: 31,060,622 L81H probably damaging Het
Lrp1 T C 10: 127,571,408 E1888G probably damaging Het
Man2a1 C T 17: 64,752,544 T1142M probably damaging Het
Mgam A T 6: 40,744,798 Y350F probably damaging Het
Miga1 T C 3: 152,290,500 D351G probably damaging Het
Mro A G 18: 73,873,314 T111A probably benign Het
Mtrr A T 13: 68,566,207 V471E probably damaging Het
Myh3 C A 11: 67,096,882 L1394I probably damaging Het
Myocd A G 11: 65,187,493 V492A probably benign Het
Nbeal2 A G 9: 110,629,179 F2115S probably damaging Het
Nlrp1b A T 11: 71,181,550 M489K possibly damaging Het
Olfr1228 T C 2: 89,248,687 probably null Het
Olfr128 A G 17: 37,924,393 I276V probably benign Het
Olfr1294 C T 2: 111,537,564 A242T possibly damaging Het
Olfr376 A T 11: 73,375,375 I212F probably benign Het
Olfr536 A C 7: 140,504,186 I91R probably damaging Het
Orc2 A G 1: 58,469,747 S462P possibly damaging Het
Pcdhb16 G A 18: 37,478,124 V46I possibly damaging Het
Pcdhb22 A G 18: 37,520,258 D336G probably damaging Het
Pde4dip T A 3: 97,719,330 R1297S probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Plxnb2 A G 15: 89,165,725 M531T possibly damaging Het
Poc5 T C 13: 96,394,525 V77A probably benign Het
Recql5 G A 11: 115,928,201 R180C probably damaging Het
Rho C A 6: 115,935,503 Y268* probably null Het
Riok1 A T 13: 38,047,312 H182L probably benign Het
Rnf207 T C 4: 152,314,091 D273G probably damaging Het
Serpinb11 A G 1: 107,377,533 Y213C probably benign Het
Slc16a10 T C 10: 40,076,955 Y181C probably damaging Het
Slc22a15 G A 3: 101,864,581 H401Y probably benign Het
Slc5a5 C A 8: 70,889,603 R268L probably damaging Het
Slc9a8 T C 2: 167,474,131 F576S possibly damaging Het
Slx4 T C 16: 3,987,099 E617G probably benign Het
Top1 T C 2: 160,704,958 I386T probably damaging Het
Tor1aip1 G T 1: 156,036,113 D41E probably damaging Het
Tsc22d4 G A 5: 137,768,109 R479Q probably benign Het
Unc79 C T 12: 103,142,702 T2191I possibly damaging Het
Vmn2r109 A T 17: 20,540,781 D771E probably damaging Het
Vmn2r82 A C 10: 79,356,630 M14L probably benign Het
Zc3h7a C T 16: 11,148,514 S583N probably damaging Het
Zfp518b G A 5: 38,682,779 probably benign Het
Zswim4 A G 8: 84,228,849 W314R probably damaging Het
Other mutations in Pcdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Pcdh9 APN 14 93326694 missense probably damaging 1.00
IGL02183:Pcdh9 APN 14 93886284 missense probably benign 0.01
IGL02244:Pcdh9 APN 14 93326768 missense probably damaging 1.00
IGL02571:Pcdh9 APN 14 93560587 splice site probably benign
IGL03018:Pcdh9 APN 14 93015576 missense probably null
I1329:Pcdh9 UTSW 14 93886209 missense probably benign 0.00
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0027:Pcdh9 UTSW 14 93888645 missense probably null 0.99
R0477:Pcdh9 UTSW 14 93887678 missense probably damaging 0.99
R0499:Pcdh9 UTSW 14 93886235 missense probably damaging 1.00
R0787:Pcdh9 UTSW 14 93886757 missense possibly damaging 0.88
R1205:Pcdh9 UTSW 14 93886065 missense probably benign 0.01
R1616:Pcdh9 UTSW 14 93886969 nonsense probably null
R1620:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1622:Pcdh9 UTSW 14 93885875 missense probably benign 0.03
R1708:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1721:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1753:Pcdh9 UTSW 14 93887225 missense probably benign 0.33
R1799:Pcdh9 UTSW 14 93888671 missense probably benign 0.36
R1867:Pcdh9 UTSW 14 93888035 missense probably damaging 1.00
R1987:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R1988:Pcdh9 UTSW 14 93888305 missense probably damaging 1.00
R2444:Pcdh9 UTSW 14 93886791 missense probably benign 0.10
R3895:Pcdh9 UTSW 14 93887538 missense probably damaging 1.00
R3926:Pcdh9 UTSW 14 93886810 nonsense probably null
R4166:Pcdh9 UTSW 14 93887520 nonsense probably null
R4429:Pcdh9 UTSW 14 93887384 missense probably damaging 0.96
R4589:Pcdh9 UTSW 14 93888192 missense probably damaging 1.00
R4604:Pcdh9 UTSW 14 93887180 missense probably damaging 1.00
R4607:Pcdh9 UTSW 14 93015573 missense probably benign 0.08
R4621:Pcdh9 UTSW 14 93887643 missense probably benign 0.12
R4624:Pcdh9 UTSW 14 93886409 missense probably damaging 1.00
R4712:Pcdh9 UTSW 14 93888631 missense probably damaging 1.00
R4788:Pcdh9 UTSW 14 93887415 missense probably damaging 1.00
R4831:Pcdh9 UTSW 14 93887941 missense probably damaging 1.00
R4883:Pcdh9 UTSW 14 93888728 missense possibly damaging 0.83
R5034:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
R5175:Pcdh9 UTSW 14 93888443 missense probably damaging 1.00
R5637:Pcdh9 UTSW 14 93885762 missense possibly damaging 0.91
R5743:Pcdh9 UTSW 14 93886724 missense probably damaging 1.00
R5753:Pcdh9 UTSW 14 93888161 missense probably damaging 1.00
R5770:Pcdh9 UTSW 14 93886943 missense probably damaging 1.00
R5900:Pcdh9 UTSW 14 93326720 missense probably damaging 0.98
R5986:Pcdh9 UTSW 14 93887048 missense probably damaging 1.00
R6052:Pcdh9 UTSW 14 93885846 missense probably benign 0.40
R6113:Pcdh9 UTSW 14 93887108 missense probably damaging 1.00
R6223:Pcdh9 UTSW 14 93015733 missense probably benign 0.18
R6415:Pcdh9 UTSW 14 93015842 missense possibly damaging 0.83
R6435:Pcdh9 UTSW 14 93887844 missense probably benign 0.01
R7064:Pcdh9 UTSW 14 93886149 missense probably damaging 1.00
R7143:Pcdh9 UTSW 14 93888272 missense probably damaging 0.99
R7219:Pcdh9 UTSW 14 93015780 missense possibly damaging 0.87
R7262:Pcdh9 UTSW 14 93015705 missense probably benign 0.01
R7369:Pcdh9 UTSW 14 93886367 missense possibly damaging 0.67
R7427:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7428:Pcdh9 UTSW 14 93887111 missense probably damaging 1.00
R7780:Pcdh9 UTSW 14 93886551 missense possibly damaging 0.91
R7870:Pcdh9 UTSW 14 93887257 missense probably damaging 0.97
R7921:Pcdh9 UTSW 14 93015565 missense probably benign
R8052:Pcdh9 UTSW 14 93885786 missense probably benign 0.00
R8252:Pcdh9 UTSW 14 93888650 missense probably damaging 1.00
X0012:Pcdh9 UTSW 14 93886644 missense possibly damaging 0.71
X0067:Pcdh9 UTSW 14 93326849 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGAGAATAGCTGTGCTCGATTTC -3'
(R):5'- TCTGTGCTGGGGCTTCATAC -3'

Sequencing Primer
(F):5'- GATTTCTGTGGCGTGCCCC -3'
(R):5'- GCTTCATACGCTGAGGAGAAC -3'
Posted On2019-09-13