Mutagenetix > Incidental Mutations

Incidental Mutation 'R7354:Plxnb2'

570837

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R7354 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89165725 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 531 (M531T)

Ref Sequence

ENSEMBL: ENSMUSP00000051731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

AlphaFold

B2RXS4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060808
AA Change: M531T

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: M531T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109331
AA Change: M531T

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: M531T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,741,834	L724*	probably null	Het
5430419D17Rik	G	T	7: 131,272,033	C1696F	unknown	Het
5430419D17Rik	G	A	7: 131,256,729	C1042Y	possibly damaging	Het
Ago3	T	A	4: 126,417,306	Q38L	possibly damaging	Het
Apon	T	A	10: 128,254,738	I95N	probably benign	Het
Arid1a	G	T	4: 133,693,947	P464Q	unknown	Het
Arid4b	A	G	13: 14,164,870	D503G	probably benign	Het
Asxl2	T	C	12: 3,455,637		probably benign	Het
Atp2a1	A	T	7: 126,448,856	V594D	probably damaging	Het
Begain	A	G	12: 109,033,289	F519L	possibly damaging	Het
Bora	A	G	14: 99,047,358	T15A	probably damaging	Het
Btbd7	A	T	12: 102,838,205	M192K	probably benign	Het
Ccdc125	T	G	13: 100,677,874		probably null	Het
Cfap74	G	T	4: 155,465,347	V146L	unknown	Het
Crisp1	G	A	17: 40,319,180		probably benign	Het
Ctbp1	A	T	5: 33,250,388	H292Q	possibly damaging	Het
Defb5	T	A	8: 19,250,734	M34K	probably benign	Het
Dnajc27	A	G	12: 4,096,249	I93V	probably benign	Het
Dqx1	T	A	6: 83,060,976	Y448*	probably null	Het
Dynap	A	T	18: 70,241,300	C52S	possibly damaging	Het
Ehd4	C	A	2: 120,102,132	R271L	probably damaging	Het
Ercc2	T	G	7: 19,393,654	I619S	possibly damaging	Het
Etf1	A	G	18: 34,905,987	I409T	probably damaging	Het
Fam117a	A	G	11: 95,380,703	D367G	probably damaging	Het
Fancd2	A	G	6: 113,595,946	D1447G	unknown	Het
Fbxw9	T	C	8: 85,062,196	S192P	probably damaging	Het
Frzb	A	T	2: 80,446,809	L11Q	probably damaging	Het
Gm14496	T	C	2: 182,000,686	S717P	probably damaging	Het
Gm3250	A	G	10: 77,782,533		probably benign	Het
Gm4353	C	T	7: 116,083,911	R145Q	probably benign	Het
Gm765	T	A	6: 98,238,281	D127V	probably damaging	Het
Gpr12	A	T	5: 146,583,962	V50D	probably damaging	Het
Hes1	T	C	16: 30,065,928		probably null	Het
Hmcn1	A	T	1: 150,806,445	C451*	probably null	Het
Iars	T	C	13: 49,704,320	V347A	probably benign	Het
Igfn1	A	G	1: 135,976,032	S323P	possibly damaging	Het
Itga6	G	A	2: 71,820,230	A207T	probably damaging	Het
Lgi4	T	A	7: 31,060,622	L81H	probably damaging	Het
Lrp1	T	C	10: 127,571,408	E1888G	probably damaging	Het
Man2a1	C	T	17: 64,752,544	T1142M	probably damaging	Het
Mgam	A	T	6: 40,744,798	Y350F	probably damaging	Het
Miga1	T	C	3: 152,290,500	D351G	probably damaging	Het
Mro	A	G	18: 73,873,314	T111A	probably benign	Het
Mtrr	A	T	13: 68,566,207	V471E	probably damaging	Het
Myh3	C	A	11: 67,096,882	L1394I	probably damaging	Het
Myocd	A	G	11: 65,187,493	V492A	probably benign	Het
Nbeal2	A	G	9: 110,629,179	F2115S	probably damaging	Het
Nlrp1b	A	T	11: 71,181,550	M489K	possibly damaging	Het
Olfr1228	T	C	2: 89,248,687		probably null	Het
Olfr128	A	G	17: 37,924,393	I276V	probably benign	Het
Olfr1294	C	T	2: 111,537,564	A242T	possibly damaging	Het
Olfr376	A	T	11: 73,375,375	I212F	probably benign	Het
Olfr536	A	C	7: 140,504,186	I91R	probably damaging	Het
Orc2	A	G	1: 58,469,747	S462P	possibly damaging	Het
Pcdh9	T	C	14: 93,888,270	T155A	probably benign	Het
Pcdhb16	G	A	18: 37,478,124	V46I	possibly damaging	Het
Pcdhb22	A	G	18: 37,520,258	D336G	probably damaging	Het
Pde4dip	T	A	3: 97,719,330	R1297S	probably damaging	Het
Plin4	A	G	17: 56,104,427	M868T	probably benign	Het
Poc5	T	C	13: 96,394,525	V77A	probably benign	Het
Recql5	G	A	11: 115,928,201	R180C	probably damaging	Het
Rho	C	A	6: 115,935,503	Y268*	probably null	Het
Riok1	A	T	13: 38,047,312	H182L	probably benign	Het
Rnf207	T	C	4: 152,314,091	D273G	probably damaging	Het
Serpinb11	A	G	1: 107,377,533	Y213C	probably benign	Het
Slc16a10	T	C	10: 40,076,955	Y181C	probably damaging	Het
Slc22a15	G	A	3: 101,864,581	H401Y	probably benign	Het
Slc5a5	C	A	8: 70,889,603	R268L	probably damaging	Het
Slc9a8	T	C	2: 167,474,131	F576S	possibly damaging	Het
Slx4	T	C	16: 3,987,099	E617G	probably benign	Het
Top1	T	C	2: 160,704,958	I386T	probably damaging	Het
Tor1aip1	G	T	1: 156,036,113	D41E	probably damaging	Het
Tsc22d4	G	A	5: 137,768,109	R479Q	probably benign	Het
Unc79	C	T	12: 103,142,702	T2191I	possibly damaging	Het
Vmn2r109	A	T	17: 20,540,781	D771E	probably damaging	Het
Vmn2r82	A	C	10: 79,356,630	M14L	probably benign	Het
Zc3h7a	C	T	16: 11,148,514	S583N	probably damaging	Het
Zfp518b	G	A	5: 38,682,779		probably benign	Het
Zswim4	A	G	8: 84,228,849	W314R	probably damaging	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R8736:Plxnb2	UTSW	15	89162058	missense	probably damaging	1.00
R8772:Plxnb2	UTSW	15	89162746	missense	probably damaging	1.00
R9022:Plxnb2	UTSW	15	89164268	missense	possibly damaging	0.59
R9253:Plxnb2	UTSW	15	89167812	missense	probably benign
R9398:Plxnb2	UTSW	15	89160919	missense	probably benign	0.02
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGACTCTGCTTTGCCTAGG -3'
(R):5'- GACTCCCAAGATCCCTACTGTG -3'

Sequencing Primer
(F):5'- CCTAGGATGTTCATGTGGGCC -3'
(R):5'- AAGATCCCTACTGTGGCTGG -3'

Posted On

2019-09-13