Mutagenetix > Incidental Mutations

Incidental Mutation 'R7355:Ros1'

570887

Institutional Source

Beutler Lab

Gene Symbol

Ros1

Ensembl Gene

ENSMUSG00000019893

Gene Name

Ros1 proto-oncogene

Synonyms

Ros-1, c-ros

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R7355 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52045721-52195244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52166079 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 250 (Q250L)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020045
AA Change: Q259L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: Q259L

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	568	654	2.24e-4	SMART
LY	734	776	2.28e1	SMART
LY	777	815	4.61e0	SMART
FN3	944	1023	5.53e-4	SMART
FN3	1037	1133	1.07e1	SMART
FN3	1440	1532	1.19e1	SMART
FN3	1551	1637	2.11e0	SMART
FN3	1649	1731	6.8e-4	SMART
FN3	1746	1832	2.7e1	SMART
TyrKc	1938	2208	1.3e-145	SMART
low complexity region	2294	2307	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117992
AA Change: Q259L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: Q259L

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
TyrKc	1917	2187	1.3e-145	SMART
low complexity region	2273	2286	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000175892
AA Change: Q250L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135235
Gene: ENSMUSG00000019893
AA Change: Q250L

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	100	178	1.05e-4	SMART
FN3	196	273	7.45e-10	SMART
Blast:LY	360	400	1e-20	BLAST
Blast:LY	449	486	4e-15	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177378
AA Change: Q259L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: Q259L

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
Blast:LY	1190	1236	2e-18	BLAST
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
transmembrane domain	1832	1854	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000218452
AA Change: Q259L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219173
AA Change: Q259L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably damaging
Transcript: ENSMUST00000219692
AA Change: Q250L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,267,647	R1469W	probably benign	Het
Acad10	G	T	5: 121,630,717	Y728*	probably null	Het
Adamts17	T	C	7: 67,075,304	V160A		Het
AI481877	T	C	4: 59,076,155	D596G	probably benign	Het
Astn1	A	T	1: 158,664,276		probably null	Het
Atp8a2	T	C	14: 60,045,004	K104E	possibly damaging	Het
Axl	T	C	7: 25,774,106	Y365C	probably benign	Het
Btbd16	A	T	7: 130,821,443	Y409F	probably benign	Het
Caln1	A	T	5: 130,414,891	T22S	probably benign	Het
Camk1	C	A	6: 113,338,346	G164C	probably damaging	Het
Cd96	T	C	16: 46,041,292	T512A	possibly damaging	Het
Ceacam5	A	G	7: 17,747,387	D353G	probably damaging	Het
Cep162	C	A	9: 87,253,955	E12*	probably null	Het
Cfh	A	T	1: 140,136,815	V365E	probably damaging	Het
Chd7	A	G	4: 8,752,196	H231R	unknown	Het
Cntnap3	T	C	13: 64,771,962	T694A	probably benign	Het
Colq	C	A	14: 31,545,109	G158V	probably damaging	Het
Ctif	G	A	18: 75,610,685	H139Y	probably damaging	Het
D630003M21Rik	A	T	2: 158,200,224	F934Y	probably damaging	Het
Dclre1a	T	A	19: 56,547,135	T6S	possibly damaging	Het
Dnmbp	T	C	19: 43,901,741	D529G	probably benign	Het
Fat2	T	A	11: 55,256,551	Q3955L	probably benign	Het
Gjd4	A	G	18: 9,280,860	S73P	probably damaging	Het
Gm14025	G	T	2: 129,037,229	Q926K	unknown	Het
Gm19410	C	A	8: 35,807,072	Q1460K	probably benign	Het
Golga5	A	T	12: 102,472,235	I70F	possibly damaging	Het
Gon4l	T	A	3: 88,863,520	I502N	probably damaging	Het
Gtf2ird2	C	G	5: 134,216,649	A583G	probably benign	Het
Hectd1	A	C	12: 51,791,298	W694G	possibly damaging	Het
Ifit1bl2	C	T	19: 34,619,661	G185D	probably damaging	Het
Igfbp6	G	A	15: 102,147,940	A145T	probably benign	Het
Junb	C	T	8: 84,978,384	A16T	probably benign	Het
Kcnh4	C	T	11: 100,752,443	V333I	possibly damaging	Het
Ly6c1	T	C	15: 75,047,407	T45A	possibly damaging	Het
Mon2	T	A	10: 123,009,516	Q1428L	probably benign	Het
Nfatc2ip	C	T	7: 126,387,611		probably null	Het
Olfml3	C	A	3: 103,736,079	G329W	probably damaging	Het
Olfr1012	C	T	2: 85,753,679	P106L	probably benign	Het
Olfr1118	T	C	2: 87,309,410	V207A	probably benign	Het
Olfr118	A	G	17: 37,672,410	Y129C	probably benign	Het
Olfr215	T	A	6: 116,582,955		probably benign	Het
Pcsk7	A	G	9: 45,909,374	M35V	probably benign	Het
Phf14	A	G	6: 12,081,007	N921S	probably benign	Het
Pla2g4e	G	A	2: 120,181,501	S396F	possibly damaging	Het
Ppp4r4	A	T	12: 103,604,582	K766*	probably null	Het
Pprc1	T	C	19: 46,065,346	V1105A	unknown	Het
Prdm9	T	G	17: 15,545,235	N428H	probably benign	Het
Prkcg	C	T	7: 3,323,509	T497I	possibly damaging	Het
Prkcz	A	G	4: 155,357,496	W60R	probably damaging	Het
Ptprn2	T	C	12: 116,858,951	F217L	probably benign	Het
Pum2	T	A	12: 8,713,906	Y283*	probably null	Het
Rest	A	G	5: 77,268,028	M30V	probably benign	Het
Rfxank	C	T	8: 70,135,307	R150H	probably damaging	Het
Sgk2	A	G	2: 163,013,067	D366G	probably benign	Het
Siglec1	A	T	2: 131,080,451	L568Q	probably benign	Het
Slain1	AT	ATT	14: 103,702,576		probably null	Het
Slc10a5	A	T	3: 10,334,315	Y428*	probably null	Het
Slc25a54	T	C	3: 109,102,769	W195R	probably damaging	Het
Slf1	A	G	13: 77,091,303	I414T	probably damaging	Het
Snx4	C	T	16: 33,266,866	P127L	probably damaging	Het
Spdl1	A	T	11: 34,823,364	L166H	not run	Het
Tapt1	C	T	5: 44,177,117	V511I	probably benign	Het
Tbata	A	G	10: 61,174,320		probably benign	Het
Tbx4	T	A	11: 85,912,009	V264E	probably damaging	Het
Tecta	A	T	9: 42,367,142	Y1023*	probably null	Het
Thop1	A	G	10: 81,075,631	D117G	probably damaging	Het
Trip12	A	G	1: 84,814,883	L13P	probably damaging	Het
Unc13b	T	A	4: 43,237,754	V637E	probably damaging	Het
Yipf3	T	A	17: 46,250,640	M168K	probably damaging	Het
Zcchc6	T	C	13: 59,821,802	N93S	probably benign	Het
Zfp119a	A	T	17: 55,866,287	C185*	probably null	Het
Zfyve21	A	T	12: 111,825,051	I157F	possibly damaging	Het
Zfyve26	A	T	12: 79,240,054	D2253E	probably damaging	Het

Other mutations in Ros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ros1	APN	10	52194890	missense	probably benign	0.01
IGL00338:Ros1	APN	10	52125811	missense	probably benign
IGL00419:Ros1	APN	10	52091054	missense	probably damaging	0.97
IGL00840:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00841:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00951:Ros1	APN	10	52143252	missense	probably damaging	0.99
IGL01123:Ros1	APN	10	52120809	missense	probably damaging	1.00
IGL01128:Ros1	APN	10	52142328	nonsense	probably null
IGL01300:Ros1	APN	10	52101713	missense	probably benign	0.01
IGL01316:Ros1	APN	10	52087879	critical splice donor site	probably null
IGL01349:Ros1	APN	10	52051026	missense	probably damaging	0.99
IGL01363:Ros1	APN	10	52166142	missense	probably damaging	1.00
IGL01457:Ros1	APN	10	52046330	splice site	probably benign
IGL01532:Ros1	APN	10	52090938	splice site	probably benign
IGL01585:Ros1	APN	10	52155102	missense	probably damaging	1.00
IGL01650:Ros1	APN	10	52154979	missense	probably damaging	0.99
IGL01672:Ros1	APN	10	52101803	missense	possibly damaging	0.92
IGL01904:Ros1	APN	10	52077911	missense	probably damaging	0.97
IGL02040:Ros1	APN	10	52115922	missense	probably damaging	0.99
IGL02053:Ros1	APN	10	52162720	missense	probably damaging	1.00
IGL02147:Ros1	APN	10	52120895	missense	probably damaging	1.00
IGL02169:Ros1	APN	10	52081957	critical splice donor site	probably null
IGL02247:Ros1	APN	10	52129581	missense	probably damaging	0.99
IGL02262:Ros1	APN	10	52178969	missense	probably damaging	0.96
IGL02307:Ros1	APN	10	52128438	missense	possibly damaging	0.53
IGL02398:Ros1	APN	10	52144884	splice site	probably benign
IGL02525:Ros1	APN	10	52116042	missense	possibly damaging	0.66
IGL02718:Ros1	APN	10	52118232	missense	probably damaging	1.00
IGL02721:Ros1	APN	10	52172831	splice site	probably benign
IGL02808:Ros1	APN	10	52125889	missense	probably damaging	1.00
IGL03009:Ros1	APN	10	52145907	missense	probably benign	0.00
IGL03035:Ros1	APN	10	52075984	splice site	probably benign
IGL03092:Ros1	APN	10	52098806	missense	probably damaging	0.99
IGL03309:Ros1	APN	10	52118261	missense	possibly damaging	0.83
IGL03333:Ros1	APN	10	52155171	missense	probably damaging	1.00
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0125:Ros1	UTSW	10	52125789	missense	probably benign	0.38
R0403:Ros1	UTSW	10	52143438	splice site	probably benign
R0487:Ros1	UTSW	10	52155108	missense	possibly damaging	0.69
R0502:Ros1	UTSW	10	52194823	splice site	probably benign
R0557:Ros1	UTSW	10	52085263	missense	possibly damaging	0.82
R0599:Ros1	UTSW	10	52123300	missense	probably damaging	1.00
R0620:Ros1	UTSW	10	52118348	missense	probably damaging	1.00
R0679:Ros1	UTSW	10	52066295	missense	possibly damaging	0.95
R1005:Ros1	UTSW	10	52128405	splice site	probably benign
R1073:Ros1	UTSW	10	52046125	missense	probably damaging	1.00
R1220:Ros1	UTSW	10	52098870	missense	probably damaging	0.97
R1279:Ros1	UTSW	10	52142166	missense	possibly damaging	0.81
R1295:Ros1	UTSW	10	52087932	missense	possibly damaging	0.92
R1336:Ros1	UTSW	10	52168662	missense	probably damaging	1.00
R1371:Ros1	UTSW	10	52087945	missense	probably damaging	0.98
R1447:Ros1	UTSW	10	52098858	missense	possibly damaging	0.66
R1486:Ros1	UTSW	10	52172858	missense	probably damaging	1.00
R1499:Ros1	UTSW	10	52098677	missense	possibly damaging	0.92
R1669:Ros1	UTSW	10	52161811	missense	probably damaging	1.00
R1744:Ros1	UTSW	10	52123379	missense	probably damaging	0.99
R1759:Ros1	UTSW	10	52120826	missense	probably damaging	1.00
R1791:Ros1	UTSW	10	52100087	missense	probably benign	0.00
R1794:Ros1	UTSW	10	52124103	nonsense	probably null
R2031:Ros1	UTSW	10	52067068	missense	possibly damaging	0.88
R2115:Ros1	UTSW	10	52128555	missense	probably benign	0.00
R2219:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R2290:Ros1	UTSW	10	52118381	missense	probably damaging	0.96
R2329:Ros1	UTSW	10	52162887	missense	probably damaging	1.00
R2371:Ros1	UTSW	10	52163895	missense	possibly damaging	0.66
R2879:Ros1	UTSW	10	52172840	critical splice donor site	probably null
R3154:Ros1	UTSW	10	52050981	missense	probably benign
R3423:Ros1	UTSW	10	52128416	unclassified	probably null
R3424:Ros1	UTSW	10	52128416	unclassified	probably null
R3425:Ros1	UTSW	10	52128416	unclassified	probably null
R3433:Ros1	UTSW	10	52091108	missense	probably benign	0.45
R3522:Ros1	UTSW	10	52090995	nonsense	probably null
R3686:Ros1	UTSW	10	52145816	missense	probably damaging	1.00
R3710:Ros1	UTSW	10	52161895	nonsense	probably null
R3771:Ros1	UTSW	10	52128991	missense	probably damaging	0.97
R3808:Ros1	UTSW	10	52120848	missense	probably benign	0.08
R3930:Ros1	UTSW	10	52194848	missense	possibly damaging	0.92
R3950:Ros1	UTSW	10	52066388	missense	probably damaging	1.00
R3981:Ros1	UTSW	10	52120878	missense	possibly damaging	0.46
R4007:Ros1	UTSW	10	52118232	missense	probably damaging	1.00
R4346:Ros1	UTSW	10	52168609	missense	possibly damaging	0.92
R4382:Ros1	UTSW	10	52120959	missense	possibly damaging	0.46
R4414:Ros1	UTSW	10	52162704	critical splice donor site	probably null
R4450:Ros1	UTSW	10	52077942	missense	probably damaging	0.98
R4468:Ros1	UTSW	10	52118356	missense	probably damaging	1.00
R4569:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R4649:Ros1	UTSW	10	52129668	missense	possibly damaging	0.66
R4684:Ros1	UTSW	10	52129096	missense	probably damaging	1.00
R4706:Ros1	UTSW	10	52101894	missense	possibly damaging	0.95
R4731:Ros1	UTSW	10	52142229	missense	probably damaging	1.00
R4748:Ros1	UTSW	10	52115997	missense	probably benign	0.00
R4806:Ros1	UTSW	10	52096175	missense	probably damaging	0.96
R4865:Ros1	UTSW	10	52172870	missense	probably damaging	0.99
R4973:Ros1	UTSW	10	52154991	missense	probably damaging	0.98
R5022:Ros1	UTSW	10	52124075	missense	possibly damaging	0.46
R5033:Ros1	UTSW	10	52128416	critical splice donor site	probably null
R5082:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5083:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5130:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5269:Ros1	UTSW	10	52051008	missense	probably damaging	1.00
R5399:Ros1	UTSW	10	52090944	critical splice donor site	probably null
R5414:Ros1	UTSW	10	52155093	missense	probably damaging	1.00
R5659:Ros1	UTSW	10	52143386	missense	possibly damaging	0.92
R5742:Ros1	UTSW	10	52142138	critical splice donor site	probably null
R5780:Ros1	UTSW	10	52194857	missense	probably damaging	1.00
R5805:Ros1	UTSW	10	52123289	missense	probably damaging	1.00
R5843:Ros1	UTSW	10	52166197	missense	possibly damaging	0.92
R5881:Ros1	UTSW	10	52181798	missense	probably benign	0.26
R6027:Ros1	UTSW	10	52163968	missense	possibly damaging	0.82
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6052:Ros1	UTSW	10	52163903	missense	probably benign	0.39
R6175:Ros1	UTSW	10	52101785	missense	probably benign	0.02
R6315:Ros1	UTSW	10	52118210	missense	probably benign
R6342:Ros1	UTSW	10	52155255	missense	probably damaging	1.00
R6470:Ros1	UTSW	10	52166044	critical splice donor site	probably null
R6527:Ros1	UTSW	10	52143377	missense	possibly damaging	0.66
R6568:Ros1	UTSW	10	52162812	missense	probably damaging	1.00
R6573:Ros1	UTSW	10	52155010	missense	possibly damaging	0.84
R6653:Ros1	UTSW	10	52142203	missense	probably damaging	1.00
R6959:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R7011:Ros1	UTSW	10	52180176	missense	probably damaging	1.00
R7111:Ros1	UTSW	10	52181810	missense	probably benign	0.02
R7243:Ros1	UTSW	10	52123381	missense	probably damaging	1.00
R7385:Ros1	UTSW	10	52155126	missense	probably benign	0.00
R7460:Ros1	UTSW	10	52118203	missense	probably damaging	1.00
R7549:Ros1	UTSW	10	52145834	missense	probably damaging	0.96
R7573:Ros1	UTSW	10	52169976	missense	probably benign	0.03
R7650:Ros1	UTSW	10	52046209	missense	probably benign	0.00
R7667:Ros1	UTSW	10	52163971	missense	probably damaging	1.00
R7696:Ros1	UTSW	10	52142283	missense	probably damaging	1.00
R7785:Ros1	UTSW	10	52162848	missense	probably damaging	1.00
R7814:Ros1	UTSW	10	52096137	missense	probably benign	0.28
R7830:Ros1	UTSW	10	52154934	missense	probably damaging	0.99
RF018:Ros1	UTSW	10	52155121	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCACTAACAGGATTTTACCTCC -3'
(R):5'- AGTTCCAGAAACTGCACCTC -3'

Sequencing Primer
(F):5'- TCTGCTTAGAATTGTGTGATCTAAC -3'
(R):5'- TCTCATCCTGAACATGGAAAGCTGG -3'

Posted On

2019-09-13