Incidental Mutation 'R7355:Ptprn2'
ID 570900
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 045441-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R7355 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116822571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 217 (F217L)
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: F217L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: F217L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190247
AA Change: F217L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: F217L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,486,621 (GRCm39) R1469W probably benign Het
Acad10 G T 5: 121,768,780 (GRCm39) Y728* probably null Het
Adamts17 T C 7: 66,725,052 (GRCm39) V160A Het
Astn1 A T 1: 158,491,846 (GRCm39) probably null Het
Atp8a2 T C 14: 60,282,453 (GRCm39) K104E possibly damaging Het
Axl T C 7: 25,473,531 (GRCm39) Y365C probably benign Het
Btbd16 A T 7: 130,423,173 (GRCm39) Y409F probably benign Het
Caln1 A T 5: 130,443,732 (GRCm39) T22S probably benign Het
Camk1 C A 6: 113,315,307 (GRCm39) G164C probably damaging Het
Cd96 T C 16: 45,861,655 (GRCm39) T512A possibly damaging Het
Ceacam5 A G 7: 17,481,312 (GRCm39) D353G probably damaging Het
Cep162 C A 9: 87,136,008 (GRCm39) E12* probably null Het
Cfh A T 1: 140,064,553 (GRCm39) V365E probably damaging Het
Chd7 A G 4: 8,752,196 (GRCm39) H231R unknown Het
Cntnap3 T C 13: 64,919,776 (GRCm39) T694A probably benign Het
Colq C A 14: 31,267,066 (GRCm39) G158V probably damaging Het
Ctif G A 18: 75,743,756 (GRCm39) H139Y probably damaging Het
D630003M21Rik A T 2: 158,042,144 (GRCm39) F934Y probably damaging Het
Dclre1a T A 19: 56,535,567 (GRCm39) T6S possibly damaging Het
Dnmbp T C 19: 43,890,180 (GRCm39) D529G probably benign Het
Fat2 T A 11: 55,147,377 (GRCm39) Q3955L probably benign Het
Gjd4 A G 18: 9,280,860 (GRCm39) S73P probably damaging Het
Gm19410 C A 8: 36,274,226 (GRCm39) Q1460K probably benign Het
Golga5 A T 12: 102,438,494 (GRCm39) I70F possibly damaging Het
Gon4l T A 3: 88,770,827 (GRCm39) I502N probably damaging Het
Gtf2ird2 C G 5: 134,245,491 (GRCm39) A583G probably benign Het
Hectd1 A C 12: 51,838,081 (GRCm39) W694G possibly damaging Het
Ifit1bl2 C T 19: 34,597,061 (GRCm39) G185D probably damaging Het
Igfbp6 G A 15: 102,056,375 (GRCm39) A145T probably benign Het
Junb C T 8: 85,705,013 (GRCm39) A16T probably benign Het
Kcnh4 C T 11: 100,643,269 (GRCm39) V333I possibly damaging Het
Ly6c1 T C 15: 74,919,256 (GRCm39) T45A possibly damaging Het
Mon2 T A 10: 122,845,421 (GRCm39) Q1428L probably benign Het
Nfatc2ip C T 7: 125,986,783 (GRCm39) probably null Het
Olfml3 C A 3: 103,643,395 (GRCm39) G329W probably damaging Het
Or10ag56 T C 2: 87,139,754 (GRCm39) V207A probably benign Het
Or10al2 A G 17: 37,983,301 (GRCm39) Y129C probably benign Het
Or6d15 T A 6: 116,559,916 (GRCm39) probably benign Het
Or9g3 C T 2: 85,584,023 (GRCm39) P106L probably benign Het
Pcsk7 A G 9: 45,820,672 (GRCm39) M35V probably benign Het
Phf14 A G 6: 12,081,006 (GRCm39) N921S probably benign Het
Pla2g4e G A 2: 120,011,982 (GRCm39) S396F possibly damaging Het
Ppp4r4 A T 12: 103,570,841 (GRCm39) K766* probably null Het
Pprc1 T C 19: 46,053,785 (GRCm39) V1105A unknown Het
Prdm9 T G 17: 15,765,497 (GRCm39) N428H probably benign Het
Prkcg C T 7: 3,372,025 (GRCm39) T497I possibly damaging Het
Prkcz A G 4: 155,441,953 (GRCm39) W60R probably damaging Het
Pum2 T A 12: 8,763,906 (GRCm39) Y283* probably null Het
Rest A G 5: 77,415,875 (GRCm39) M30V probably benign Het
Rfxank C T 8: 70,587,957 (GRCm39) R150H probably damaging Het
Ros1 T A 10: 52,042,175 (GRCm39) Q250L probably damaging Het
Sgk2 A G 2: 162,854,987 (GRCm39) D366G probably benign Het
Shoc1 T C 4: 59,076,155 (GRCm39) D596G probably benign Het
Siglec1 A T 2: 130,922,371 (GRCm39) L568Q probably benign Het
Slain1 AT ATT 14: 103,940,012 (GRCm39) probably null Het
Slc10a5 A T 3: 10,399,375 (GRCm39) Y428* probably null Het
Slc25a54 T C 3: 109,010,085 (GRCm39) W195R probably damaging Het
Slf1 A G 13: 77,239,422 (GRCm39) I414T probably damaging Het
Snx4 C T 16: 33,087,236 (GRCm39) P127L probably damaging Het
Spdl1 A T 11: 34,714,191 (GRCm39) L166H not run Het
Tapt1 C T 5: 44,334,459 (GRCm39) V511I probably benign Het
Tbata A G 10: 61,010,099 (GRCm39) probably benign Het
Tbx4 T A 11: 85,802,835 (GRCm39) V264E probably damaging Het
Tecta A T 9: 42,278,438 (GRCm39) Y1023* probably null Het
Thop1 A G 10: 80,911,465 (GRCm39) D117G probably damaging Het
Trip12 A G 1: 84,792,604 (GRCm39) L13P probably damaging Het
Tut7 T C 13: 59,969,616 (GRCm39) N93S probably benign Het
Unc13b T A 4: 43,237,754 (GRCm39) V637E probably damaging Het
Vinac1 G T 2: 128,879,149 (GRCm39) Q926K unknown Het
Yipf3 T A 17: 46,561,566 (GRCm39) M168K probably damaging Het
Zfp119a A T 17: 56,173,287 (GRCm39) C185* probably null Het
Zfyve21 A T 12: 111,791,485 (GRCm39) I157F possibly damaging Het
Zfyve26 A T 12: 79,286,828 (GRCm39) D2253E probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAAGCTTTCTGCCACTGG -3'
(R):5'- CTCTGAGACAAAGCAGTTGC -3'

Sequencing Primer
(F):5'- ACTGGGCCACTCGGATG -3'
(R):5'- GCAGTTGCTGAGAATGGCC -3'
Posted On 2019-09-13