Incidental Mutation 'R7355:Ptprn2'
ID570900
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Nameprotein tyrosine phosphatase, receptor type, N polypeptide 2
Synonymsphogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R7355 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location116485720-117276849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116858951 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 217 (F217L)
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: F217L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: F217L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190247
AA Change: F217L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: F217L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,267,647 R1469W probably benign Het
Acad10 G T 5: 121,630,717 Y728* probably null Het
Adamts17 T C 7: 67,075,304 V160A Het
AI481877 T C 4: 59,076,155 D596G probably benign Het
Astn1 A T 1: 158,664,276 probably null Het
Atp8a2 T C 14: 60,045,004 K104E possibly damaging Het
Axl T C 7: 25,774,106 Y365C probably benign Het
Btbd16 A T 7: 130,821,443 Y409F probably benign Het
Caln1 A T 5: 130,414,891 T22S probably benign Het
Camk1 C A 6: 113,338,346 G164C probably damaging Het
Cd96 T C 16: 46,041,292 T512A possibly damaging Het
Ceacam5 A G 7: 17,747,387 D353G probably damaging Het
Cep162 C A 9: 87,253,955 E12* probably null Het
Cfh A T 1: 140,136,815 V365E probably damaging Het
Chd7 A G 4: 8,752,196 H231R unknown Het
Cntnap3 T C 13: 64,771,962 T694A probably benign Het
Colq C A 14: 31,545,109 G158V probably damaging Het
Ctif G A 18: 75,610,685 H139Y probably damaging Het
D630003M21Rik A T 2: 158,200,224 F934Y probably damaging Het
Dclre1a T A 19: 56,547,135 T6S possibly damaging Het
Dnmbp T C 19: 43,901,741 D529G probably benign Het
Fat2 T A 11: 55,256,551 Q3955L probably benign Het
Gjd4 A G 18: 9,280,860 S73P probably damaging Het
Gm14025 G T 2: 129,037,229 Q926K unknown Het
Gm19410 C A 8: 35,807,072 Q1460K probably benign Het
Golga5 A T 12: 102,472,235 I70F possibly damaging Het
Gon4l T A 3: 88,863,520 I502N probably damaging Het
Gtf2ird2 C G 5: 134,216,649 A583G probably benign Het
Hectd1 A C 12: 51,791,298 W694G possibly damaging Het
Ifit1bl2 C T 19: 34,619,661 G185D probably damaging Het
Igfbp6 G A 15: 102,147,940 A145T probably benign Het
Junb C T 8: 84,978,384 A16T probably benign Het
Kcnh4 C T 11: 100,752,443 V333I possibly damaging Het
Ly6c1 T C 15: 75,047,407 T45A possibly damaging Het
Mon2 T A 10: 123,009,516 Q1428L probably benign Het
Nfatc2ip C T 7: 126,387,611 probably null Het
Olfml3 C A 3: 103,736,079 G329W probably damaging Het
Olfr1012 C T 2: 85,753,679 P106L probably benign Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr118 A G 17: 37,672,410 Y129C probably benign Het
Olfr215 T A 6: 116,582,955 probably benign Het
Pcsk7 A G 9: 45,909,374 M35V probably benign Het
Phf14 A G 6: 12,081,007 N921S probably benign Het
Pla2g4e G A 2: 120,181,501 S396F possibly damaging Het
Ppp4r4 A T 12: 103,604,582 K766* probably null Het
Pprc1 T C 19: 46,065,346 V1105A unknown Het
Prdm9 T G 17: 15,545,235 N428H probably benign Het
Prkcg C T 7: 3,323,509 T497I possibly damaging Het
Prkcz A G 4: 155,357,496 W60R probably damaging Het
Pum2 T A 12: 8,713,906 Y283* probably null Het
Rest A G 5: 77,268,028 M30V probably benign Het
Rfxank C T 8: 70,135,307 R150H probably damaging Het
Ros1 T A 10: 52,166,079 Q250L probably damaging Het
Sgk2 A G 2: 163,013,067 D366G probably benign Het
Siglec1 A T 2: 131,080,451 L568Q probably benign Het
Slain1 AT ATT 14: 103,702,576 probably null Het
Slc10a5 A T 3: 10,334,315 Y428* probably null Het
Slc25a54 T C 3: 109,102,769 W195R probably damaging Het
Slf1 A G 13: 77,091,303 I414T probably damaging Het
Snx4 C T 16: 33,266,866 P127L probably damaging Het
Spdl1 A T 11: 34,823,364 L166H not run Het
Tapt1 C T 5: 44,177,117 V511I probably benign Het
Tbata A G 10: 61,174,320 probably benign Het
Tbx4 T A 11: 85,912,009 V264E probably damaging Het
Tecta A T 9: 42,367,142 Y1023* probably null Het
Thop1 A G 10: 81,075,631 D117G probably damaging Het
Trip12 A G 1: 84,814,883 L13P probably damaging Het
Unc13b T A 4: 43,237,754 V637E probably damaging Het
Yipf3 T A 17: 46,250,640 M168K probably damaging Het
Zcchc6 T C 13: 59,821,802 N93S probably benign Het
Zfp119a A T 17: 55,866,287 C185* probably null Het
Zfyve21 A T 12: 111,825,051 I157F possibly damaging Het
Zfyve26 A T 12: 79,240,054 D2253E probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116580428 missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116722133 missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116824396 missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117233365 splice site probably null
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117211862 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116485866 start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116722119 missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116841320 missense probably benign 0.10
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGAGAAGCTTTCTGCCACTGG -3'
(R):5'- CTCTGAGACAAAGCAGTTGC -3'

Sequencing Primer
(F):5'- ACTGGGCCACTCGGATG -3'
(R):5'- GCAGTTGCTGAGAATGGCC -3'
Posted On2019-09-13