Incidental Mutation 'R7355:Cntnap3'
ID 570902
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission 045441-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R7355 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 64883996-65051769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64919776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 694 (T694A)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect probably benign
Transcript: ENSMUST00000091554
AA Change: T694A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: T694A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,486,621 (GRCm39) R1469W probably benign Het
Acad10 G T 5: 121,768,780 (GRCm39) Y728* probably null Het
Adamts17 T C 7: 66,725,052 (GRCm39) V160A Het
Astn1 A T 1: 158,491,846 (GRCm39) probably null Het
Atp8a2 T C 14: 60,282,453 (GRCm39) K104E possibly damaging Het
Axl T C 7: 25,473,531 (GRCm39) Y365C probably benign Het
Btbd16 A T 7: 130,423,173 (GRCm39) Y409F probably benign Het
Caln1 A T 5: 130,443,732 (GRCm39) T22S probably benign Het
Camk1 C A 6: 113,315,307 (GRCm39) G164C probably damaging Het
Cd96 T C 16: 45,861,655 (GRCm39) T512A possibly damaging Het
Ceacam5 A G 7: 17,481,312 (GRCm39) D353G probably damaging Het
Cep162 C A 9: 87,136,008 (GRCm39) E12* probably null Het
Cfh A T 1: 140,064,553 (GRCm39) V365E probably damaging Het
Chd7 A G 4: 8,752,196 (GRCm39) H231R unknown Het
Colq C A 14: 31,267,066 (GRCm39) G158V probably damaging Het
Ctif G A 18: 75,743,756 (GRCm39) H139Y probably damaging Het
D630003M21Rik A T 2: 158,042,144 (GRCm39) F934Y probably damaging Het
Dclre1a T A 19: 56,535,567 (GRCm39) T6S possibly damaging Het
Dnmbp T C 19: 43,890,180 (GRCm39) D529G probably benign Het
Fat2 T A 11: 55,147,377 (GRCm39) Q3955L probably benign Het
Gjd4 A G 18: 9,280,860 (GRCm39) S73P probably damaging Het
Gm19410 C A 8: 36,274,226 (GRCm39) Q1460K probably benign Het
Golga5 A T 12: 102,438,494 (GRCm39) I70F possibly damaging Het
Gon4l T A 3: 88,770,827 (GRCm39) I502N probably damaging Het
Gtf2ird2 C G 5: 134,245,491 (GRCm39) A583G probably benign Het
Hectd1 A C 12: 51,838,081 (GRCm39) W694G possibly damaging Het
Ifit1bl2 C T 19: 34,597,061 (GRCm39) G185D probably damaging Het
Igfbp6 G A 15: 102,056,375 (GRCm39) A145T probably benign Het
Junb C T 8: 85,705,013 (GRCm39) A16T probably benign Het
Kcnh4 C T 11: 100,643,269 (GRCm39) V333I possibly damaging Het
Ly6c1 T C 15: 74,919,256 (GRCm39) T45A possibly damaging Het
Mon2 T A 10: 122,845,421 (GRCm39) Q1428L probably benign Het
Nfatc2ip C T 7: 125,986,783 (GRCm39) probably null Het
Olfml3 C A 3: 103,643,395 (GRCm39) G329W probably damaging Het
Or10ag56 T C 2: 87,139,754 (GRCm39) V207A probably benign Het
Or10al2 A G 17: 37,983,301 (GRCm39) Y129C probably benign Het
Or6d15 T A 6: 116,559,916 (GRCm39) probably benign Het
Or9g3 C T 2: 85,584,023 (GRCm39) P106L probably benign Het
Pcsk7 A G 9: 45,820,672 (GRCm39) M35V probably benign Het
Phf14 A G 6: 12,081,006 (GRCm39) N921S probably benign Het
Pla2g4e G A 2: 120,011,982 (GRCm39) S396F possibly damaging Het
Ppp4r4 A T 12: 103,570,841 (GRCm39) K766* probably null Het
Pprc1 T C 19: 46,053,785 (GRCm39) V1105A unknown Het
Prdm9 T G 17: 15,765,497 (GRCm39) N428H probably benign Het
Prkcg C T 7: 3,372,025 (GRCm39) T497I possibly damaging Het
Prkcz A G 4: 155,441,953 (GRCm39) W60R probably damaging Het
Ptprn2 T C 12: 116,822,571 (GRCm39) F217L probably benign Het
Pum2 T A 12: 8,763,906 (GRCm39) Y283* probably null Het
Rest A G 5: 77,415,875 (GRCm39) M30V probably benign Het
Rfxank C T 8: 70,587,957 (GRCm39) R150H probably damaging Het
Ros1 T A 10: 52,042,175 (GRCm39) Q250L probably damaging Het
Sgk2 A G 2: 162,854,987 (GRCm39) D366G probably benign Het
Shoc1 T C 4: 59,076,155 (GRCm39) D596G probably benign Het
Siglec1 A T 2: 130,922,371 (GRCm39) L568Q probably benign Het
Slain1 AT ATT 14: 103,940,012 (GRCm39) probably null Het
Slc10a5 A T 3: 10,399,375 (GRCm39) Y428* probably null Het
Slc25a54 T C 3: 109,010,085 (GRCm39) W195R probably damaging Het
Slf1 A G 13: 77,239,422 (GRCm39) I414T probably damaging Het
Snx4 C T 16: 33,087,236 (GRCm39) P127L probably damaging Het
Spdl1 A T 11: 34,714,191 (GRCm39) L166H not run Het
Tapt1 C T 5: 44,334,459 (GRCm39) V511I probably benign Het
Tbata A G 10: 61,010,099 (GRCm39) probably benign Het
Tbx4 T A 11: 85,802,835 (GRCm39) V264E probably damaging Het
Tecta A T 9: 42,278,438 (GRCm39) Y1023* probably null Het
Thop1 A G 10: 80,911,465 (GRCm39) D117G probably damaging Het
Trip12 A G 1: 84,792,604 (GRCm39) L13P probably damaging Het
Tut7 T C 13: 59,969,616 (GRCm39) N93S probably benign Het
Unc13b T A 4: 43,237,754 (GRCm39) V637E probably damaging Het
Vinac1 G T 2: 128,879,149 (GRCm39) Q926K unknown Het
Yipf3 T A 17: 46,561,566 (GRCm39) M168K probably damaging Het
Zfp119a A T 17: 56,173,287 (GRCm39) C185* probably null Het
Zfyve21 A T 12: 111,791,485 (GRCm39) I157F possibly damaging Het
Zfyve26 A T 12: 79,286,828 (GRCm39) D2253E probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64,920,545 (GRCm39) missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64,893,619 (GRCm39) splice site probably benign
IGL00976:Cntnap3 APN 13 64,942,166 (GRCm39) missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64,935,651 (GRCm39) missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64,905,115 (GRCm39) missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64,946,922 (GRCm39) missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64,946,878 (GRCm39) splice site probably benign
IGL02133:Cntnap3 APN 13 64,899,487 (GRCm39) splice site probably benign
IGL02251:Cntnap3 APN 13 64,909,850 (GRCm39) missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64,905,225 (GRCm39) missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64,899,565 (GRCm39) missense probably benign
IGL02456:Cntnap3 APN 13 64,946,872 (GRCm39) splice site probably benign
IGL02589:Cntnap3 APN 13 64,940,244 (GRCm39) missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64,919,946 (GRCm39) missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64,905,223 (GRCm39) missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64,888,839 (GRCm39) missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64,929,559 (GRCm39) missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 65,035,582 (GRCm39) nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64,905,024 (GRCm39) missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64,905,250 (GRCm39) splice site probably benign
R0422:Cntnap3 UTSW 13 64,905,099 (GRCm39) missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64,926,690 (GRCm39) missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64,909,859 (GRCm39) missense probably benign 0.01
R0499:Cntnap3 UTSW 13 65,006,492 (GRCm39) missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64,909,814 (GRCm39) missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64,906,228 (GRCm39) missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64,905,211 (GRCm39) missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64,935,724 (GRCm39) missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64,906,104 (GRCm39) missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64,909,816 (GRCm39) missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64,888,626 (GRCm39) critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64,888,406 (GRCm39) missense probably benign 0.17
R1905:Cntnap3 UTSW 13 65,051,578 (GRCm39) missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64,906,204 (GRCm39) missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64,942,076 (GRCm39) missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64,888,813 (GRCm39) missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64,896,274 (GRCm39) missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64,926,667 (GRCm39) missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64,926,697 (GRCm39) missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64,926,602 (GRCm39) critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64,926,676 (GRCm39) missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64,935,520 (GRCm39) missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64,909,798 (GRCm39) missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64,942,162 (GRCm39) missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64,909,824 (GRCm39) missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64,909,792 (GRCm39) missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 65,051,572 (GRCm39) missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64,894,552 (GRCm39) missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64,935,769 (GRCm39) missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64,896,391 (GRCm39) missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64,946,994 (GRCm39) missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64,935,583 (GRCm39) missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64,929,702 (GRCm39) missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64,896,373 (GRCm39) missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64,929,539 (GRCm39) critical splice donor site probably null
R7425:Cntnap3 UTSW 13 64,906,066 (GRCm39) missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64,919,815 (GRCm39) missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64,920,591 (GRCm39) nonsense probably null
R7810:Cntnap3 UTSW 13 64,941,122 (GRCm39) missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 65,051,587 (GRCm39) missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64,935,681 (GRCm39) missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64,886,479 (GRCm39) missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64,933,157 (GRCm39) missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64,929,573 (GRCm39) missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64,899,532 (GRCm39) missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 65,051,648 (GRCm39) missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64,946,949 (GRCm39) missense probably damaging 1.00
R9625:Cntnap3 UTSW 13 65,006,579 (GRCm39) missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64,899,562 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64,940,202 (GRCm39) missense probably damaging 0.98
Z1176:Cntnap3 UTSW 13 64,888,686 (GRCm39) frame shift probably null
Z1177:Cntnap3 UTSW 13 64,929,706 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCATGCCCAATGAACATTC -3'
(R):5'- CACAGCATGGACTGTTGTTC -3'

Sequencing Primer
(F):5'- CATTCCTTAAGATATCAGGGGTGTTC -3'
(R):5'- TTGTTCAGCATGGAGGCCC -3'
Posted On 2019-09-13