Mutagenetix > Incidental Mutation

Incidental Mutation 'R7355:Cntnap3'

570902

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R7355 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64771962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 694 (T694A)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably benign
Transcript: ENSMUST00000091554
AA Change: T694A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: T694A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,267,647	R1469W	probably benign	Het
Acad10	G	T	5: 121,630,717	Y728*	probably null	Het
Adamts17	T	C	7: 67,075,304	V160A		Het
AI481877	T	C	4: 59,076,155	D596G	probably benign	Het
Astn1	A	T	1: 158,664,276		probably null	Het
Atp8a2	T	C	14: 60,045,004	K104E	possibly damaging	Het
Axl	T	C	7: 25,774,106	Y365C	probably benign	Het
Btbd16	A	T	7: 130,821,443	Y409F	probably benign	Het
Caln1	A	T	5: 130,414,891	T22S	probably benign	Het
Camk1	C	A	6: 113,338,346	G164C	probably damaging	Het
Cd96	T	C	16: 46,041,292	T512A	possibly damaging	Het
Ceacam5	A	G	7: 17,747,387	D353G	probably damaging	Het
Cep162	C	A	9: 87,253,955	E12*	probably null	Het
Cfh	A	T	1: 140,136,815	V365E	probably damaging	Het
Chd7	A	G	4: 8,752,196	H231R	unknown	Het
Colq	C	A	14: 31,545,109	G158V	probably damaging	Het
Ctif	G	A	18: 75,610,685	H139Y	probably damaging	Het
D630003M21Rik	A	T	2: 158,200,224	F934Y	probably damaging	Het
Dclre1a	T	A	19: 56,547,135	T6S	possibly damaging	Het
Dnmbp	T	C	19: 43,901,741	D529G	probably benign	Het
Fat2	T	A	11: 55,256,551	Q3955L	probably benign	Het
Gjd4	A	G	18: 9,280,860	S73P	probably damaging	Het
Gm14025	G	T	2: 129,037,229	Q926K	unknown	Het
Gm19410	C	A	8: 35,807,072	Q1460K	probably benign	Het
Golga5	A	T	12: 102,472,235	I70F	possibly damaging	Het
Gon4l	T	A	3: 88,863,520	I502N	probably damaging	Het
Gtf2ird2	C	G	5: 134,216,649	A583G	probably benign	Het
Hectd1	A	C	12: 51,791,298	W694G	possibly damaging	Het
Ifit1bl2	C	T	19: 34,619,661	G185D	probably damaging	Het
Igfbp6	G	A	15: 102,147,940	A145T	probably benign	Het
Junb	C	T	8: 84,978,384	A16T	probably benign	Het
Kcnh4	C	T	11: 100,752,443	V333I	possibly damaging	Het
Ly6c1	T	C	15: 75,047,407	T45A	possibly damaging	Het
Mon2	T	A	10: 123,009,516	Q1428L	probably benign	Het
Nfatc2ip	C	T	7: 126,387,611		probably null	Het
Olfml3	C	A	3: 103,736,079	G329W	probably damaging	Het
Olfr1012	C	T	2: 85,753,679	P106L	probably benign	Het
Olfr1118	T	C	2: 87,309,410	V207A	probably benign	Het
Olfr118	A	G	17: 37,672,410	Y129C	probably benign	Het
Olfr215	T	A	6: 116,582,955		probably benign	Het
Pcsk7	A	G	9: 45,909,374	M35V	probably benign	Het
Phf14	A	G	6: 12,081,007	N921S	probably benign	Het
Pla2g4e	G	A	2: 120,181,501	S396F	possibly damaging	Het
Ppp4r4	A	T	12: 103,604,582	K766*	probably null	Het
Pprc1	T	C	19: 46,065,346	V1105A	unknown	Het
Prdm9	T	G	17: 15,545,235	N428H	probably benign	Het
Prkcg	C	T	7: 3,323,509	T497I	possibly damaging	Het
Prkcz	A	G	4: 155,357,496	W60R	probably damaging	Het
Ptprn2	T	C	12: 116,858,951	F217L	probably benign	Het
Pum2	T	A	12: 8,713,906	Y283*	probably null	Het
Rest	A	G	5: 77,268,028	M30V	probably benign	Het
Rfxank	C	T	8: 70,135,307	R150H	probably damaging	Het
Ros1	T	A	10: 52,166,079	Q250L	probably damaging	Het
Sgk2	A	G	2: 163,013,067	D366G	probably benign	Het
Siglec1	A	T	2: 131,080,451	L568Q	probably benign	Het
Slain1	AT	ATT	14: 103,702,576		probably null	Het
Slc10a5	A	T	3: 10,334,315	Y428*	probably null	Het
Slc25a54	T	C	3: 109,102,769	W195R	probably damaging	Het
Slf1	A	G	13: 77,091,303	I414T	probably damaging	Het
Snx4	C	T	16: 33,266,866	P127L	probably damaging	Het
Spdl1	A	T	11: 34,823,364	L166H	not run	Het
Tapt1	C	T	5: 44,177,117	V511I	probably benign	Het
Tbata	A	G	10: 61,174,320		probably benign	Het
Tbx4	T	A	11: 85,912,009	V264E	probably damaging	Het
Tecta	A	T	9: 42,367,142	Y1023*	probably null	Het
Thop1	A	G	10: 81,075,631	D117G	probably damaging	Het
Trip12	A	G	1: 84,814,883	L13P	probably damaging	Het
Unc13b	T	A	4: 43,237,754	V637E	probably damaging	Het
Yipf3	T	A	17: 46,250,640	M168K	probably damaging	Het
Zcchc6	T	C	13: 59,821,802	N93S	probably benign	Het
Zfp119a	A	T	17: 55,866,287	C185*	probably null	Het
Zfyve21	A	T	12: 111,825,051	I157F	possibly damaging	Het
Zfyve26	A	T	12: 79,240,054	D2253E	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGCATGCCCAATGAACATTC -3'
(R):5'- CACAGCATGGACTGTTGTTC -3'

Sequencing Primer
(F):5'- CATTCCTTAAGATATCAGGGGTGTTC -3'
(R):5'- TTGTTCAGCATGGAGGCCC -3'

Posted On

2019-09-13