Incidental Mutation 'R0645:Uggt2'
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene NameUDP-glucose glycoprotein glucosyltransferase 2
Synonyms3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik
MMRRC Submission 038830-MU
Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0645 (G1)
Quality Score145
Status Validated
Chromosomal Location118985039-119099430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119057598 bp
Amino Acid Change Tyrosine to Aspartic acid at position 539 (Y539D)
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]
Predicted Effect probably benign
Transcript: ENSMUST00000127153
AA Change: Y63D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104
AA Change: Y63D

low complexity region 327 334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136924
Predicted Effect probably benign
Transcript: ENSMUST00000156203
AA Change: Y539D

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: Y539D

signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119049276 missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119026429 nonsense probably null
IGL00433:Uggt2 APN 14 119013487 missense probably benign
IGL00572:Uggt2 APN 14 119042791 missense probably benign 0.02
IGL00577:Uggt2 APN 14 119034900 missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119042799 missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119057645 missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119042772 missense probably benign 0.00
IGL01787:Uggt2 APN 14 119081734 missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119089193 missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119090738 missense probably benign 0.17
IGL02894:Uggt2 APN 14 119081799 missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119075346 missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119095310 missense probably benign 0.25
IGL03142:Uggt2 APN 14 118998191 missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119077668 missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119070888 missense probably benign 0.38
P0014:Uggt2 UTSW 14 119044538 missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119049663 missense probably benign 0.07
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0383:Uggt2 UTSW 14 119049451 missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119075329 critical splice donor site probably null
R0472:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0788:Uggt2 UTSW 14 119095400 splice site probably benign
R0940:Uggt2 UTSW 14 119091192 critical splice donor site probably null
R1567:Uggt2 UTSW 14 119009093 missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119057663 missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119054643 missense probably benign 0.19
R1746:Uggt2 UTSW 14 119013503 missense probably benign 0.00
R1785:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119032276 missense probably benign 0.00
R1894:Uggt2 UTSW 14 119049718 missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119008055 splice site probably benign
R2149:Uggt2 UTSW 14 119075345 missense probably benign 0.02
R2168:Uggt2 UTSW 14 119019505 missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2240:Uggt2 UTSW 14 118995049 missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119026599 missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119059109 missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2907:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2908:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2998:Uggt2 UTSW 14 119049385 missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119091270 missense probably benign 0.39
R3722:Uggt2 UTSW 14 119041518 missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119057672 missense probably benign 0.13
R4015:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119049262 missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119019558 missense probably benign
R4642:Uggt2 UTSW 14 119034935 missense probably benign 0.00
R4654:Uggt2 UTSW 14 119032258 missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119029054 splice site probably null
R4810:Uggt2 UTSW 14 119013521 missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119001847 missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119035964 splice site probably null
R4886:Uggt2 UTSW 14 119035964 splice site probably null
R4888:Uggt2 UTSW 14 119049253 missense probably damaging 1.00
R4888:Uggt2 UTSW 14 119077650 critical splice donor site probably null
R4895:Uggt2 UTSW 14 119018886 missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119081770 missense probably benign 0.00
R5423:Uggt2 UTSW 14 119019486 missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119090709 missense probably benign 0.01
R5561:Uggt2 UTSW 14 119041527 missense probably benign 0.02
R5607:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119077724 missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119042726 missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119049426 missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6056:Uggt2 UTSW 14 119035969 critical splice donor site probably null
R6289:Uggt2 UTSW 14 119041602 missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119057564 missense probably benign 0.01
R6515:Uggt2 UTSW 14 119077719 missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119070881 missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119042610 missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119026435 missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119001859 missense probably benign 0.10
R7117:Uggt2 UTSW 14 119014526 missense probably benign 0.25
R7183:Uggt2 UTSW 14 119019637 splice site probably null
R7337:Uggt2 UTSW 14 119086175 missense probably benign 0.28
R7342:Uggt2 UTSW 14 118994972 missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119089269 missense probably benign 0.12
R7625:Uggt2 UTSW 14 119026493 missense probably damaging 1.00
R7685:Uggt2 UTSW 14 119075347 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgcctgcttataatactgggac -3'
Posted On2013-07-11