Incidental Mutation 'R7355:Abca17'
ID570912
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7355 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24267647 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1469 (R1469W)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: R1469W

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: R1469W

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121226
AA Change: R1469W

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: R1469W

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,630,717 Y728* probably null Het
Adamts17 T C 7: 67,075,304 V160A Het
AI481877 T C 4: 59,076,155 D596G probably benign Het
Astn1 A T 1: 158,664,276 probably null Het
Atp8a2 T C 14: 60,045,004 K104E possibly damaging Het
Axl T C 7: 25,774,106 Y365C probably benign Het
Btbd16 A T 7: 130,821,443 Y409F probably benign Het
Caln1 A T 5: 130,414,891 T22S probably benign Het
Camk1 C A 6: 113,338,346 G164C probably damaging Het
Cd96 T C 16: 46,041,292 T512A possibly damaging Het
Ceacam5 A G 7: 17,747,387 D353G probably damaging Het
Cep162 C A 9: 87,253,955 E12* probably null Het
Cfh A T 1: 140,136,815 V365E probably damaging Het
Chd7 A G 4: 8,752,196 H231R unknown Het
Cntnap3 T C 13: 64,771,962 T694A probably benign Het
Colq C A 14: 31,545,109 G158V probably damaging Het
Ctif G A 18: 75,610,685 H139Y probably damaging Het
D630003M21Rik A T 2: 158,200,224 F934Y probably damaging Het
Dclre1a T A 19: 56,547,135 T6S possibly damaging Het
Dnmbp T C 19: 43,901,741 D529G probably benign Het
Fat2 T A 11: 55,256,551 Q3955L probably benign Het
Gjd4 A G 18: 9,280,860 S73P probably damaging Het
Gm14025 G T 2: 129,037,229 Q926K unknown Het
Gm19410 C A 8: 35,807,072 Q1460K probably benign Het
Golga5 A T 12: 102,472,235 I70F possibly damaging Het
Gon4l T A 3: 88,863,520 I502N probably damaging Het
Gtf2ird2 C G 5: 134,216,649 A583G probably benign Het
Hectd1 A C 12: 51,791,298 W694G possibly damaging Het
Ifit1bl2 C T 19: 34,619,661 G185D probably damaging Het
Igfbp6 G A 15: 102,147,940 A145T probably benign Het
Junb C T 8: 84,978,384 A16T probably benign Het
Kcnh4 C T 11: 100,752,443 V333I possibly damaging Het
Ly6c1 T C 15: 75,047,407 T45A possibly damaging Het
Mon2 T A 10: 123,009,516 Q1428L probably benign Het
Nfatc2ip C T 7: 126,387,611 probably null Het
Olfml3 C A 3: 103,736,079 G329W probably damaging Het
Olfr1012 C T 2: 85,753,679 P106L probably benign Het
Olfr1118 T C 2: 87,309,410 V207A probably benign Het
Olfr118 A G 17: 37,672,410 Y129C probably benign Het
Olfr215 T A 6: 116,582,955 probably benign Het
Pcsk7 A G 9: 45,909,374 M35V probably benign Het
Phf14 A G 6: 12,081,007 N921S probably benign Het
Pla2g4e G A 2: 120,181,501 S396F possibly damaging Het
Ppp4r4 A T 12: 103,604,582 K766* probably null Het
Pprc1 T C 19: 46,065,346 V1105A unknown Het
Prdm9 T G 17: 15,545,235 N428H probably benign Het
Prkcg C T 7: 3,323,509 T497I possibly damaging Het
Prkcz A G 4: 155,357,496 W60R probably damaging Het
Ptprn2 T C 12: 116,858,951 F217L probably benign Het
Pum2 T A 12: 8,713,906 Y283* probably null Het
Rest A G 5: 77,268,028 M30V probably benign Het
Rfxank C T 8: 70,135,307 R150H probably damaging Het
Ros1 T A 10: 52,166,079 Q250L probably damaging Het
Sgk2 A G 2: 163,013,067 D366G probably benign Het
Siglec1 A T 2: 131,080,451 L568Q probably benign Het
Slain1 AT ATT 14: 103,702,576 probably null Het
Slc10a5 A T 3: 10,334,315 Y428* probably null Het
Slc25a54 T C 3: 109,102,769 W195R probably damaging Het
Slf1 A G 13: 77,091,303 I414T probably damaging Het
Snx4 C T 16: 33,266,866 P127L probably damaging Het
Spdl1 A T 11: 34,823,364 L166H not run Het
Tapt1 C T 5: 44,177,117 V511I probably benign Het
Tbata A G 10: 61,174,320 probably benign Het
Tbx4 T A 11: 85,912,009 V264E probably damaging Het
Tecta A T 9: 42,367,142 Y1023* probably null Het
Thop1 A G 10: 81,075,631 D117G probably damaging Het
Trip12 A G 1: 84,814,883 L13P probably damaging Het
Unc13b T A 4: 43,237,754 V637E probably damaging Het
Yipf3 T A 17: 46,250,640 M168K probably damaging Het
Zcchc6 T C 13: 59,821,802 N93S probably benign Het
Zfp119a A T 17: 55,866,287 C185* probably null Het
Zfyve21 A T 12: 111,825,051 I157F possibly damaging Het
Zfyve26 A T 12: 79,240,054 D2253E probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGACAGGCTTTACTCTACAATCC -3'
(R):5'- AGCAAAACTGAAGCTCCAGG -3'

Sequencing Primer
(F):5'- ACTCTACAATCCAGTTCTGAGAAG -3'
(R):5'- ACTGAAGCTCCAGGCCCAG -3'
Posted On2019-09-13