Incidental Mutation 'R7356:Hltf'
ID570934
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Namehelicase-like transcription factor
SynonymsP113, Snf2l3, Smarca3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7356 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location20057811-20118490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20109370 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 888 (I888T)
Ref Sequence ENSEMBL: ENSMUSP00000002502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
Predicted Effect probably damaging
Transcript: ENSMUST00000002502
AA Change: I888T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: I888T

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143005
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145853
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A T 4: 49,383,507 D15E probably damaging Het
Adamts16 G A 13: 70,836,280 T88I probably benign Het
Akap6 A C 12: 52,911,864 N801H probably damaging Het
Ankfn1 G T 11: 89,434,773 N524K probably damaging Het
Ap5s1 A G 2: 131,212,662 N131S probably damaging Het
Astn2 A T 4: 66,185,266 D303E unknown Het
Babam1 T C 8: 71,399,564 V132A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC 3: 95,888,141 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGCTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,158 probably benign Het
BC028528 GGTCACTGGTTCTGT GGTCACTGGTTCTGTAGTCACTGGTTCTGT 3: 95,888,165 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTCCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
BC028528 CACTGGTT CACTGGTTCTATGGTGACTGGTT 3: 95,888,183 probably benign Het
Cnst C T 1: 179,606,530 P304S probably benign Het
Cog4 A T 8: 110,849,866 probably null Het
Cyp2j13 A T 4: 96,077,418 H17Q probably benign Het
Ddx58 A G 4: 40,226,600 S231P probably benign Het
Dock6 G A 9: 21,809,899 T1662I probably damaging Het
Dysf T C 6: 84,067,461 F270S probably damaging Het
Erbb4 A G 1: 68,339,355 probably null Het
Fam120b A T 17: 15,407,696 Q550L probably benign Het
Fam83b A T 9: 76,492,853 F323I probably benign Het
Far1 T A 7: 113,568,142 I478N possibly damaging Het
Gdpd5 T A 7: 99,458,878 I554N probably damaging Het
Glrx3 T C 7: 137,452,724 S79P probably damaging Het
Hpx A G 7: 105,591,710 V452A probably damaging Het
Itk T G 11: 46,367,832 Q81P possibly damaging Het
Kdm6b G A 11: 69,402,165 Q1262* probably null Het
Lpcat2 T C 8: 92,864,983 V85A probably benign Het
Lrrk2 A T 15: 91,738,744 H1039L probably benign Het
Mapk3 T C 7: 126,760,915 probably null Het
Masp1 A T 16: 23,470,243 N602K possibly damaging Het
Myo7a T A 7: 98,102,683 Q40L probably benign Het
Nek1 A T 8: 61,120,960 M1081L probably benign Het
Nes T C 3: 87,977,751 S1106P possibly damaging Het
Nkpd1 A T 7: 19,523,774 I493F probably damaging Het
Npsr1 C G 9: 24,098,261 S21C probably benign Het
Olfr1001-ps1 G A 2: 85,633,438 R3K probably benign Het
Olfr175-ps1 A T 16: 58,824,355 M118K probably damaging Het
Olfr738 G A 14: 50,413,702 V53M probably damaging Het
Oog1 G A 12: 87,606,277 probably null Het
Osbpl9 G T 4: 109,068,480 Y340* probably null Het
Pcyox1l A T 18: 61,707,550 L11Q probably null Het
Pdxdc1 G A 16: 13,860,003 R255C probably damaging Het
Pgap1 A G 1: 54,530,134 S358P probably benign Het
Pgm2l1 A G 7: 100,268,119 Y481C possibly damaging Het
Plekhf1 T C 7: 38,222,121 T8A possibly damaging Het
Plg G T 17: 12,410,911 G611C probably damaging Het
Prf1 A C 10: 61,303,280 D339A possibly damaging Het
Prph A G 15: 99,056,926 Y291C probably damaging Het
Rasal1 A G 5: 120,654,825 S48G possibly damaging Het
Ripk4 T A 16: 97,743,149 Q766L probably damaging Het
Scaf1 T C 7: 45,007,784 D557G unknown Het
Scaper A T 9: 55,892,211 M190K unknown Het
Scn8a A T 15: 100,957,579 I202F probably damaging Het
Siglecf A G 7: 43,356,431 I505V probably benign Het
Sirpb1c A G 3: 15,832,133 S360P probably benign Het
Sla2 C A 2: 156,878,703 probably null Het
Slc11a1 G T 1: 74,385,489 V544L probably benign Het
Slco1a5 T A 6: 142,234,732 K648I probably benign Het
Sorcs1 T A 19: 50,175,157 I1020F possibly damaging Het
Spen C A 4: 141,471,924 E3131* probably null Het
Sult2a7 A T 7: 14,477,106 W162R probably damaging Het
Sult3a1 G A 10: 33,866,583 E69K probably benign Het
Tcof1 G T 18: 60,818,094 D1119E unknown Het
Tom1l2 A T 11: 60,249,027 I272K probably damaging Het
Tspan5 C T 3: 138,742,432 probably benign Het
Ttn A G 2: 76,867,900 L186P Het
Uap1l1 T C 2: 25,361,684 E496G possibly damaging Het
Ube2v1 A T 2: 167,609,195 I117N possibly damaging Het
Usp42 A G 5: 143,717,087 V593A possibly damaging Het
Virma T A 4: 11,513,595 I483N probably damaging Het
Vwde T A 6: 13,192,642 I421F probably damaging Het
Zfp345 G A 2: 150,472,289 H443Y probably damaging Het
Zfp760 A G 17: 21,722,620 T259A probably benign Het
Zfp941 T C 7: 140,812,115 I444V possibly damaging Het
Zfyve9 A C 4: 108,719,015 S290A probably benign Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20105632 splice site probably benign
IGL01461:Hltf APN 3 20099939 nonsense probably null
IGL01630:Hltf APN 3 20082904 splice site probably benign
IGL01704:Hltf APN 3 20083746 splice site probably benign
IGL02059:Hltf APN 3 20106457 missense probably benign
IGL02105:Hltf APN 3 20092757 missense probably damaging 1.00
IGL02156:Hltf APN 3 20092807 missense possibly damaging 0.61
IGL02870:Hltf APN 3 20099873 missense probably damaging 0.98
IGL02899:Hltf APN 3 20099817 missense probably damaging 1.00
IGL02935:Hltf APN 3 20069051 missense probably damaging 1.00
IGL02950:Hltf APN 3 20076572 missense probably benign 0.07
IGL03082:Hltf APN 3 20064559 splice site probably benign
snarky UTSW 3 20109487 critical splice donor site probably null
R0068:Hltf UTSW 3 20059090 missense probably damaging 1.00
R0787:Hltf UTSW 3 20106446 missense probably damaging 1.00
R0905:Hltf UTSW 3 20108869 critical splice donor site probably null
R0980:Hltf UTSW 3 20091501 missense probably benign 0.00
R1741:Hltf UTSW 3 20086188 missense probably damaging 1.00
R1748:Hltf UTSW 3 20076521 missense probably benign 0.13
R1799:Hltf UTSW 3 20105691 missense probably damaging 1.00
R1976:Hltf UTSW 3 20106446 missense probably damaging 1.00
R2171:Hltf UTSW 3 20059081 missense probably damaging 1.00
R2395:Hltf UTSW 3 20092742 missense probably benign 0.41
R2444:Hltf UTSW 3 20063907 missense possibly damaging 0.66
R3789:Hltf UTSW 3 20069047 missense probably damaging 1.00
R3943:Hltf UTSW 3 20092744 missense probably damaging 1.00
R4719:Hltf UTSW 3 20064701 critical splice donor site probably null
R4793:Hltf UTSW 3 20063950 missense possibly damaging 0.79
R5296:Hltf UTSW 3 20108112 missense probably damaging 0.99
R5449:Hltf UTSW 3 20069083 missense possibly damaging 0.92
R5492:Hltf UTSW 3 20098067 splice site probably null
R6012:Hltf UTSW 3 20058934 missense probably damaging 1.00
R6157:Hltf UTSW 3 20076496 missense probably benign 0.13
R6254:Hltf UTSW 3 20063829 missense possibly damaging 0.85
R6553:Hltf UTSW 3 20072394 missense probably damaging 0.96
R6616:Hltf UTSW 3 20109487 critical splice donor site probably null
R6696:Hltf UTSW 3 20065306 intron probably null
R6761:Hltf UTSW 3 20083832 critical splice donor site probably null
R6781:Hltf UTSW 3 20098166 missense probably benign 0.00
R7241:Hltf UTSW 3 20065392 missense probably benign 0.07
R7453:Hltf UTSW 3 20082752 missense possibly damaging 0.81
X0027:Hltf UTSW 3 20067389 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGGGCCTTGAGTTTGACTG -3'
(R):5'- ACAGTTGGAATCACAGAACCG -3'

Sequencing Primer
(F):5'- TGACTGATCTTTAGTACCACAGG -3'
(R):5'- AGGCACCTCTCAAACAGGTTTTG -3'
Posted On2019-09-13