Incidental Mutation 'R7356:BC028528'
ID570936
Institutional Source Beutler Lab
Gene Symbol BC028528
Ensembl Gene ENSMUSG00000038543
Gene NamecDNA sequence BC028528
SynonymsL259
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7356 (G1)
Quality Score214.458
Status Not validated
Chromosome3
Chromosomal Location95883954-95892005 bp(-) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT at 95888136 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036360] [ENSMUST00000090476] [ENSMUST00000171519]
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A T 4: 49,383,507 D15E probably damaging Het
Adamts16 G A 13: 70,836,280 T88I probably benign Het
Akap6 A C 12: 52,911,864 N801H probably damaging Het
Ankfn1 G T 11: 89,434,773 N524K probably damaging Het
Ap5s1 A G 2: 131,212,662 N131S probably damaging Het
Astn2 A T 4: 66,185,266 D303E unknown Het
Babam1 T C 8: 71,399,564 V132A probably benign Het
Cnst C T 1: 179,606,530 P304S probably benign Het
Cog4 A T 8: 110,849,866 probably null Het
Cyp2j13 A T 4: 96,077,418 H17Q probably benign Het
Ddx58 A G 4: 40,226,600 S231P probably benign Het
Dock6 G A 9: 21,809,899 T1662I probably damaging Het
Dysf T C 6: 84,067,461 F270S probably damaging Het
Erbb4 A G 1: 68,339,355 probably null Het
Fam120b A T 17: 15,407,696 Q550L probably benign Het
Fam83b A T 9: 76,492,853 F323I probably benign Het
Far1 T A 7: 113,568,142 I478N possibly damaging Het
Gdpd5 T A 7: 99,458,878 I554N probably damaging Het
Glrx3 T C 7: 137,452,724 S79P probably damaging Het
Hltf T C 3: 20,109,370 I888T probably damaging Het
Hpx A G 7: 105,591,710 V452A probably damaging Het
Itk T G 11: 46,367,832 Q81P possibly damaging Het
Kdm6b G A 11: 69,402,165 Q1262* probably null Het
Lpcat2 T C 8: 92,864,983 V85A probably benign Het
Lrrk2 A T 15: 91,738,744 H1039L probably benign Het
Mapk3 T C 7: 126,760,915 probably null Het
Masp1 A T 16: 23,470,243 N602K possibly damaging Het
Myo7a T A 7: 98,102,683 Q40L probably benign Het
Nek1 A T 8: 61,120,960 M1081L probably benign Het
Nes T C 3: 87,977,751 S1106P possibly damaging Het
Nkpd1 A T 7: 19,523,774 I493F probably damaging Het
Npsr1 C G 9: 24,098,261 S21C probably benign Het
Olfr1001-ps1 G A 2: 85,633,438 R3K probably benign Het
Olfr175-ps1 A T 16: 58,824,355 M118K probably damaging Het
Olfr738 G A 14: 50,413,702 V53M probably damaging Het
Oog1 G A 12: 87,606,277 probably null Het
Osbpl9 G T 4: 109,068,480 Y340* probably null Het
Pcyox1l A T 18: 61,707,550 L11Q probably null Het
Pdxdc1 G A 16: 13,860,003 R255C probably damaging Het
Pgap1 A G 1: 54,530,134 S358P probably benign Het
Pgm2l1 A G 7: 100,268,119 Y481C possibly damaging Het
Plekhf1 T C 7: 38,222,121 T8A possibly damaging Het
Plg G T 17: 12,410,911 G611C probably damaging Het
Prf1 A C 10: 61,303,280 D339A possibly damaging Het
Prph A G 15: 99,056,926 Y291C probably damaging Het
Rasal1 A G 5: 120,654,825 S48G possibly damaging Het
Ripk4 T A 16: 97,743,149 Q766L probably damaging Het
Scaf1 T C 7: 45,007,784 D557G unknown Het
Scaper A T 9: 55,892,211 M190K unknown Het
Scn8a A T 15: 100,957,579 I202F probably damaging Het
Siglecf A G 7: 43,356,431 I505V probably benign Het
Sirpb1c A G 3: 15,832,133 S360P probably benign Het
Sla2 C A 2: 156,878,703 probably null Het
Slc11a1 G T 1: 74,385,489 V544L probably benign Het
Slco1a5 T A 6: 142,234,732 K648I probably benign Het
Sorcs1 T A 19: 50,175,157 I1020F possibly damaging Het
Spen C A 4: 141,471,924 E3131* probably null Het
Sult2a7 A T 7: 14,477,106 W162R probably damaging Het
Sult3a1 G A 10: 33,866,583 E69K probably benign Het
Tcof1 G T 18: 60,818,094 D1119E unknown Het
Tom1l2 A T 11: 60,249,027 I272K probably damaging Het
Tspan5 C T 3: 138,742,432 probably benign Het
Ttn A G 2: 76,867,900 L186P Het
Uap1l1 T C 2: 25,361,684 E496G possibly damaging Het
Ube2v1 A T 2: 167,609,195 I117N possibly damaging Het
Usp42 A G 5: 143,717,087 V593A possibly damaging Het
Virma T A 4: 11,513,595 I483N probably damaging Het
Vwde T A 6: 13,192,642 I421F probably damaging Het
Zfp345 G A 2: 150,472,289 H443Y probably damaging Het
Zfp760 A G 17: 21,722,620 T259A probably benign Het
Zfp941 T C 7: 140,812,115 I444V possibly damaging Het
Zfyve9 A C 4: 108,719,015 S290A probably benign Het
Other mutations in BC028528
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:BC028528 APN 3 95888900 missense probably damaging 1.00
R0157:BC028528 UTSW 3 95884968 critical splice donor site probably null
R0164:BC028528 UTSW 3 95887334 intron probably benign
R0306:BC028528 UTSW 3 95889820 unclassified probably benign
R1478:BC028528 UTSW 3 95891959 unclassified probably null
R4204:BC028528 UTSW 3 95889745 nonsense probably null
R4649:BC028528 UTSW 3 95888265 missense probably damaging 0.99
R5022:BC028528 UTSW 3 95888823 intron probably benign
R6541:BC028528 UTSW 3 95888218 missense probably benign 0.00
R6683:BC028528 UTSW 3 95888227 missense probably damaging 1.00
R6980:BC028528 UTSW 3 95888136 small insertion probably benign
R6980:BC028528 UTSW 3 95888139 small insertion probably benign
R6980:BC028528 UTSW 3 95888168 small insertion probably benign
R7058:BC028528 UTSW 3 95885011 missense possibly damaging 0.84
R7180:BC028528 UTSW 3 95888136 small insertion probably benign
R7308:BC028528 UTSW 3 95888136 small insertion probably benign
R7308:BC028528 UTSW 3 95888152 small insertion probably benign
R7308:BC028528 UTSW 3 95888169 small insertion probably benign
R7310:BC028528 UTSW 3 95888136 small insertion probably benign
R7310:BC028528 UTSW 3 95888139 small insertion probably benign
R7310:BC028528 UTSW 3 95888148 small insertion probably benign
R7310:BC028528 UTSW 3 95888173 small insertion probably benign
R7356:BC028528 UTSW 3 95888141 small insertion probably benign
R7356:BC028528 UTSW 3 95888158 small insertion probably benign
R7356:BC028528 UTSW 3 95888165 small insertion probably benign
R7356:BC028528 UTSW 3 95888175 small insertion probably benign
R7356:BC028528 UTSW 3 95888183 small insertion probably benign
R7376:BC028528 UTSW 3 95888136 small insertion probably benign
R7430:BC028528 UTSW 3 95888136 small insertion probably benign
R7430:BC028528 UTSW 3 95888169 small insertion probably benign
R7490:BC028528 UTSW 3 95888136 small insertion probably benign
R7490:BC028528 UTSW 3 95888166 small insertion probably benign
R7490:BC028528 UTSW 3 95888186 small insertion probably benign
R7491:BC028528 UTSW 3 95888136 small insertion probably benign
R7491:BC028528 UTSW 3 95888138 small insertion probably benign
R7496:BC028528 UTSW 3 95888177 small insertion probably benign
R7497:BC028528 UTSW 3 95888136 small insertion probably benign
R7497:BC028528 UTSW 3 95888171 small insertion probably benign
R7498:BC028528 UTSW 3 95888136 small insertion probably benign
R7498:BC028528 UTSW 3 95888182 small insertion probably benign
R7552:BC028528 UTSW 3 95888169 small insertion probably benign
R7565:BC028528 UTSW 3 95888136 small insertion probably benign
R7565:BC028528 UTSW 3 95888138 small insertion probably benign
R7565:BC028528 UTSW 3 95888144 small insertion probably benign
R7566:BC028528 UTSW 3 95888136 small insertion probably benign
R7566:BC028528 UTSW 3 95888145 small insertion probably benign
R7568:BC028528 UTSW 3 95888136 small insertion probably benign
R7568:BC028528 UTSW 3 95888151 small insertion probably benign
R7568:BC028528 UTSW 3 95888172 small insertion probably benign
R7569:BC028528 UTSW 3 95888136 small insertion probably benign
R7580:BC028528 UTSW 3 95888136 small insertion probably benign
R7580:BC028528 UTSW 3 95888140 small insertion probably benign
R7635:BC028528 UTSW 3 95888136 small insertion probably benign
R7672:BC028528 UTSW 3 95888136 small insertion probably benign
R7672:BC028528 UTSW 3 95888143 small insertion probably benign
R7672:BC028528 UTSW 3 95888175 small insertion probably benign
R7685:BC028528 UTSW 3 95888136 small insertion probably benign
R7685:BC028528 UTSW 3 95888153 small insertion probably benign
R7685:BC028528 UTSW 3 95888156 small insertion probably benign
R7685:BC028528 UTSW 3 95888183 nonsense probably null
R7686:BC028528 UTSW 3 95888136 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTTGTCCTCTGTCCTCAAC -3'
(R):5'- AATCCTACCGAGGGCAGAACAG -3'

Sequencing Primer
(F):5'- CAATTGGAGAATTGCCTCTGTCAG -3'
(R):5'- CAGGTTGAATAAGGAGGTAACAAC -3'
Posted On2019-09-13