Incidental Mutation 'R7356:Astn2'
ID570946
Institutional Source Beutler Lab
Gene Symbol Astn2
Ensembl Gene ENSMUSG00000028373
Gene Nameastrotactin 2
Synonyms1d8, Astnl
MMRRC Submission
Accession Numbers

Genbank: NM_019514.3, NM_207109.2; Ensembl: ENSMUST00000068214,   ENSMUST00000084496

Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7356 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location65380803-66404611 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66185266 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 303 (D303E)
Ref Sequence ENSEMBL: ENSMUSP00000065786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]
Predicted Effect unknown
Transcript: ENSMUST00000068214
AA Change: D303E
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: D303E

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084496
AA Change: D303E

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: D303E

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A T 4: 49,383,507 D15E probably damaging Het
Adamts16 G A 13: 70,836,280 T88I probably benign Het
Akap6 A C 12: 52,911,864 N801H probably damaging Het
Ankfn1 G T 11: 89,434,773 N524K probably damaging Het
Ap5s1 A G 2: 131,212,662 N131S probably damaging Het
Babam1 T C 8: 71,399,564 V132A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC 3: 95,888,141 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGCTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,158 probably benign Het
BC028528 GGTCACTGGTTCTGT GGTCACTGGTTCTGTAGTCACTGGTTCTGT 3: 95,888,165 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTCCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
BC028528 CACTGGTT CACTGGTTCTATGGTGACTGGTT 3: 95,888,183 probably benign Het
Cnst C T 1: 179,606,530 P304S probably benign Het
Cog4 A T 8: 110,849,866 probably null Het
Cyp2j13 A T 4: 96,077,418 H17Q probably benign Het
Ddx58 A G 4: 40,226,600 S231P probably benign Het
Dock6 G A 9: 21,809,899 T1662I probably damaging Het
Dysf T C 6: 84,067,461 F270S probably damaging Het
Erbb4 A G 1: 68,339,355 probably null Het
Fam120b A T 17: 15,407,696 Q550L probably benign Het
Fam83b A T 9: 76,492,853 F323I probably benign Het
Far1 T A 7: 113,568,142 I478N possibly damaging Het
Gdpd5 T A 7: 99,458,878 I554N probably damaging Het
Glrx3 T C 7: 137,452,724 S79P probably damaging Het
Hltf T C 3: 20,109,370 I888T probably damaging Het
Hpx A G 7: 105,591,710 V452A probably damaging Het
Itk T G 11: 46,367,832 Q81P possibly damaging Het
Kdm6b G A 11: 69,402,165 Q1262* probably null Het
Lpcat2 T C 8: 92,864,983 V85A probably benign Het
Lrrk2 A T 15: 91,738,744 H1039L probably benign Het
Mapk3 T C 7: 126,760,915 probably null Het
Masp1 A T 16: 23,470,243 N602K possibly damaging Het
Myo7a T A 7: 98,102,683 Q40L probably benign Het
Nek1 A T 8: 61,120,960 M1081L probably benign Het
Nes T C 3: 87,977,751 S1106P possibly damaging Het
Nkpd1 A T 7: 19,523,774 I493F probably damaging Het
Npsr1 C G 9: 24,098,261 S21C probably benign Het
Olfr1001-ps1 G A 2: 85,633,438 R3K probably benign Het
Olfr175-ps1 A T 16: 58,824,355 M118K probably damaging Het
Olfr738 G A 14: 50,413,702 V53M probably damaging Het
Oog1 G A 12: 87,606,277 probably null Het
Osbpl9 G T 4: 109,068,480 Y340* probably null Het
Pcyox1l A T 18: 61,707,550 L11Q probably null Het
Pdxdc1 G A 16: 13,860,003 R255C probably damaging Het
Pgap1 A G 1: 54,530,134 S358P probably benign Het
Pgm2l1 A G 7: 100,268,119 Y481C possibly damaging Het
Plekhf1 T C 7: 38,222,121 T8A possibly damaging Het
Plg G T 17: 12,410,911 G611C probably damaging Het
Prf1 A C 10: 61,303,280 D339A possibly damaging Het
Prph A G 15: 99,056,926 Y291C probably damaging Het
Rasal1 A G 5: 120,654,825 S48G possibly damaging Het
Ripk4 T A 16: 97,743,149 Q766L probably damaging Het
Scaf1 T C 7: 45,007,784 D557G unknown Het
Scaper A T 9: 55,892,211 M190K unknown Het
Scn8a A T 15: 100,957,579 I202F probably damaging Het
Siglecf A G 7: 43,356,431 I505V probably benign Het
Sirpb1c A G 3: 15,832,133 S360P probably benign Het
Sla2 C A 2: 156,878,703 probably null Het
Slc11a1 G T 1: 74,385,489 V544L probably benign Het
Slco1a5 T A 6: 142,234,732 K648I probably benign Het
Sorcs1 T A 19: 50,175,157 I1020F possibly damaging Het
Spen C A 4: 141,471,924 E3131* probably null Het
Sult2a7 A T 7: 14,477,106 W162R probably damaging Het
Sult3a1 G A 10: 33,866,583 E69K probably benign Het
Tcof1 G T 18: 60,818,094 D1119E unknown Het
Tom1l2 A T 11: 60,249,027 I272K probably damaging Het
Tspan5 C T 3: 138,742,432 probably benign Het
Ttn A G 2: 76,867,900 L186P Het
Uap1l1 T C 2: 25,361,684 E496G possibly damaging Het
Ube2v1 A T 2: 167,609,195 I117N possibly damaging Het
Usp42 A G 5: 143,717,087 V593A possibly damaging Het
Virma T A 4: 11,513,595 I483N probably damaging Het
Vwde T A 6: 13,192,642 I421F probably damaging Het
Zfp345 G A 2: 150,472,289 H443Y probably damaging Het
Zfp760 A G 17: 21,722,620 T259A probably benign Het
Zfp941 T C 7: 140,812,115 I444V possibly damaging Het
Zfyve9 A C 4: 108,719,015 S290A probably benign Het
Other mutations in Astn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Astn2 APN 4 66185187 missense unknown
IGL01657:Astn2 APN 4 65651949 missense probably damaging 0.99
IGL01747:Astn2 APN 4 65794618 missense probably benign 0.17
IGL02008:Astn2 APN 4 66059153 missense probably damaging 1.00
IGL02215:Astn2 APN 4 66266234 missense unknown
IGL02484:Astn2 APN 4 65992279 splice site probably benign
IGL02494:Astn2 APN 4 65992348 missense probably benign 0.23
IGL02792:Astn2 APN 4 65644821 missense probably benign 0.32
IGL03248:Astn2 APN 4 65746293 splice site probably benign
IGL03409:Astn2 APN 4 65435186 missense possibly damaging 0.46
B6584:Astn2 UTSW 4 65992387 missense probably damaging 0.99
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0092:Astn2 UTSW 4 66403982 missense unknown
R0245:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0528:Astn2 UTSW 4 65644882 splice site probably benign
R0586:Astn2 UTSW 4 66185142 missense unknown
R0652:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0880:Astn2 UTSW 4 65648330 missense probably damaging 0.99
R0931:Astn2 UTSW 4 65648293 missense probably damaging 0.99
R1353:Astn2 UTSW 4 66266335 missense unknown
R1700:Astn2 UTSW 4 65746354 nonsense probably null
R1934:Astn2 UTSW 4 65435189 missense probably damaging 0.99
R2017:Astn2 UTSW 4 65540941 missense probably damaging 0.99
R2101:Astn2 UTSW 4 65581686 nonsense probably null
R2158:Astn2 UTSW 4 66404254 missense unknown
R2907:Astn2 UTSW 4 65644856 missense possibly damaging 0.92
R2923:Astn2 UTSW 4 65913773 missense probably damaging 1.00
R2938:Astn2 UTSW 4 65992313 missense possibly damaging 0.92
R3033:Astn2 UTSW 4 65644706 missense probably damaging 1.00
R3933:Astn2 UTSW 4 66403955 missense unknown
R4151:Astn2 UTSW 4 65729320 critical splice donor site probably null
R4230:Astn2 UTSW 4 65911682 missense probably damaging 0.99
R4497:Astn2 UTSW 4 66119063 intron probably benign
R4717:Astn2 UTSW 4 65644754 missense possibly damaging 0.86
R4844:Astn2 UTSW 4 65644730 missense possibly damaging 0.90
R4928:Astn2 UTSW 4 65729407 missense probably damaging 0.98
R5374:Astn2 UTSW 4 65397005 missense probably damaging 0.96
R5442:Astn2 UTSW 4 65581786 missense possibly damaging 0.86
R5694:Astn2 UTSW 4 65950138 missense probably damaging 1.00
R5756:Astn2 UTSW 4 66119188 intron probably benign
R5763:Astn2 UTSW 4 65729331 missense probably benign 0.14
R6089:Astn2 UTSW 4 65794573 missense probably damaging 0.96
R6990:Astn2 UTSW 4 65992303 missense possibly damaging 0.82
R7304:Astn2 UTSW 4 66185375 missense unknown
R7325:Astn2 UTSW 4 65542669 missense probably benign 0.33
R7414:Astn2 UTSW 4 65540956 missense possibly damaging 0.85
R7755:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R7887:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R7970:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R8027:Astn2 UTSW 4 65540971 missense possibly damaging 0.86
R8046:Astn2 UTSW 4 66266350 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTATGCCCCAGGAAAGACAGAG -3'
(R):5'- GGTGGACTCATTGCACTTCTC -3'

Sequencing Primer
(F):5'- CAGAGTGTAAAAAGGGCTCACC -3'
(R):5'- ACTGTATGCCCAGCGACG -3'
Posted On2019-09-13