Incidental Mutation 'R7356:Spen'
ID 570950
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Name spen family transcription repressor
Synonyms Mint
MMRRC Submission 045442-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7356 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 141195201-141265908 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 141199235 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 3131 (E3131*)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006377
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215

BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078886
AA Change: E3108*
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: E3108*

RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105786
AA Change: E3131*
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: E3131*

RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A T 4: 49,383,507 (GRCm39) D15E probably damaging Het
Adamts16 G A 13: 70,984,399 (GRCm39) T88I probably benign Het
Akap6 A C 12: 52,958,647 (GRCm39) N801H probably damaging Het
Ankfn1 G T 11: 89,325,599 (GRCm39) N524K probably damaging Het
Ap5s1 A G 2: 131,054,582 (GRCm39) N131S probably damaging Het
Astn2 A T 4: 66,103,503 (GRCm39) D303E unknown Het
Babam1 T C 8: 71,852,208 (GRCm39) V132A probably benign Het
BC028528 CACTGGTT CACTGGTTCTATGGTGACTGGTT 3: 95,795,495 (GRCm39) probably benign Het
Cnst C T 1: 179,434,095 (GRCm39) P304S probably benign Het
Cog4 A T 8: 111,576,498 (GRCm39) probably null Het
Cyp2j13 A T 4: 95,965,655 (GRCm39) H17Q probably benign Het
Dock6 G A 9: 21,721,195 (GRCm39) T1662I probably damaging Het
Dysf T C 6: 84,044,443 (GRCm39) F270S probably damaging Het
Erbb4 A G 1: 68,378,514 (GRCm39) probably null Het
Fam120b A T 17: 15,627,958 (GRCm39) Q550L probably benign Het
Fam83b A T 9: 76,400,135 (GRCm39) F323I probably benign Het
Far1 T A 7: 113,167,349 (GRCm39) I478N possibly damaging Het
Gdpd5 T A 7: 99,108,085 (GRCm39) I554N probably damaging Het
Glrx3 T C 7: 137,054,453 (GRCm39) S79P probably damaging Het
Hltf T C 3: 20,163,534 (GRCm39) I888T probably damaging Het
Hpx A G 7: 105,240,917 (GRCm39) V452A probably damaging Het
Itk T G 11: 46,258,659 (GRCm39) Q81P possibly damaging Het
Kdm6b G A 11: 69,292,991 (GRCm39) Q1262* probably null Het
Lpcat2 T C 8: 93,591,611 (GRCm39) V85A probably benign Het
Lrrk2 A T 15: 91,622,947 (GRCm39) H1039L probably benign Het
Mapk3 T C 7: 126,360,087 (GRCm39) probably null Het
Masp1 A T 16: 23,288,993 (GRCm39) N602K possibly damaging Het
Myo7a T A 7: 97,751,890 (GRCm39) Q40L probably benign Het
Nek1 A T 8: 61,573,994 (GRCm39) M1081L probably benign Het
Nes T C 3: 87,885,058 (GRCm39) S1106P possibly damaging Het
Nkpd1 A T 7: 19,257,699 (GRCm39) I493F probably damaging Het
Npsr1 C G 9: 24,009,557 (GRCm39) S21C probably benign Het
Oog1 G A 12: 87,653,047 (GRCm39) probably null Het
Or11g1 G A 14: 50,651,159 (GRCm39) V53M probably damaging Het
Or5g24-ps1 G A 2: 85,463,782 (GRCm39) R3K probably benign Het
Or5k8 A T 16: 58,644,718 (GRCm39) M118K probably damaging Het
Osbpl9 G T 4: 108,925,677 (GRCm39) Y340* probably null Het
Pcyox1l A T 18: 61,840,621 (GRCm39) L11Q probably null Het
Pdxdc1 G A 16: 13,677,867 (GRCm39) R255C probably damaging Het
Pgap1 A G 1: 54,569,293 (GRCm39) S358P probably benign Het
Pgm2l1 A G 7: 99,917,326 (GRCm39) Y481C possibly damaging Het
Plekhf1 T C 7: 37,921,545 (GRCm39) T8A possibly damaging Het
Plg G T 17: 12,629,798 (GRCm39) G611C probably damaging Het
Prf1 A C 10: 61,139,059 (GRCm39) D339A possibly damaging Het
Prph A G 15: 98,954,807 (GRCm39) Y291C probably damaging Het
Rasal1 A G 5: 120,792,890 (GRCm39) S48G possibly damaging Het
Rigi A G 4: 40,226,600 (GRCm39) S231P probably benign Het
Ripk4 T A 16: 97,544,349 (GRCm39) Q766L probably damaging Het
Scaf1 T C 7: 44,657,208 (GRCm39) D557G unknown Het
Scaper A T 9: 55,799,495 (GRCm39) M190K unknown Het
Scn8a A T 15: 100,855,460 (GRCm39) I202F probably damaging Het
Siglecf A G 7: 43,005,855 (GRCm39) I505V probably benign Het
Sirpb1c A G 3: 15,886,297 (GRCm39) S360P probably benign Het
Sla2 C A 2: 156,720,623 (GRCm39) probably null Het
Slc11a1 G T 1: 74,424,648 (GRCm39) V544L probably benign Het
Slco1a5 T A 6: 142,180,458 (GRCm39) K648I probably benign Het
Sorcs1 T A 19: 50,163,595 (GRCm39) I1020F possibly damaging Het
Sult2a7 A T 7: 14,211,031 (GRCm39) W162R probably damaging Het
Sult3a1 G A 10: 33,742,579 (GRCm39) E69K probably benign Het
Tcof1 G T 18: 60,951,166 (GRCm39) D1119E unknown Het
Tom1l2 A T 11: 60,139,853 (GRCm39) I272K probably damaging Het
Tspan5 C T 3: 138,448,193 (GRCm39) probably benign Het
Ttn A G 2: 76,698,244 (GRCm39) L186P Het
Uap1l1 T C 2: 25,251,696 (GRCm39) E496G possibly damaging Het
Ube2v1 A T 2: 167,451,115 (GRCm39) I117N possibly damaging Het
Usp42 A G 5: 143,702,842 (GRCm39) V593A possibly damaging Het
Virma T A 4: 11,513,595 (GRCm39) I483N probably damaging Het
Vwde T A 6: 13,192,641 (GRCm39) I421F probably damaging Het
Zfp345 G A 2: 150,314,209 (GRCm39) H443Y probably damaging Het
Zfp760 A G 17: 21,941,601 (GRCm39) T259A probably benign Het
Zfp941 T C 7: 140,392,028 (GRCm39) I444V possibly damaging Het
Zfyve9 A C 4: 108,576,212 (GRCm39) S290A probably benign Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141,217,212 (GRCm39) missense unknown
IGL01357:Spen APN 4 141,244,424 (GRCm39) missense unknown
IGL02184:Spen APN 4 141,214,917 (GRCm39) missense unknown
IGL02226:Spen APN 4 141,205,457 (GRCm39) missense unknown
IGL02321:Spen APN 4 141,244,441 (GRCm39) missense unknown
IGL02350:Spen APN 4 141,204,890 (GRCm39) missense unknown
IGL02357:Spen APN 4 141,204,890 (GRCm39) missense unknown
IGL02627:Spen APN 4 141,200,326 (GRCm39) missense probably damaging 0.99
IGL02683:Spen APN 4 141,198,956 (GRCm39) missense probably benign 0.06
IGL02945:Spen APN 4 141,221,624 (GRCm39) missense unknown
IGL02950:Spen APN 4 141,196,819 (GRCm39) missense probably damaging 1.00
IGL03008:Spen APN 4 141,203,448 (GRCm39) missense possibly damaging 0.70
IGL03019:Spen APN 4 141,206,227 (GRCm39) missense unknown
IGL03038:Spen APN 4 141,265,550 (GRCm39) missense unknown
IGL03334:Spen APN 4 141,197,280 (GRCm39) missense probably damaging 1.00
filtered UTSW 4 141,204,683 (GRCm39) missense unknown
mentholated UTSW 4 141,196,711 (GRCm39) missense possibly damaging 0.78
R0105:Spen UTSW 4 141,197,121 (GRCm39) splice site probably benign
R0268:Spen UTSW 4 141,204,868 (GRCm39) missense unknown
R0359:Spen UTSW 4 141,244,181 (GRCm39) missense unknown
R0394:Spen UTSW 4 141,201,514 (GRCm39) missense probably benign 0.03
R0423:Spen UTSW 4 141,206,647 (GRCm39) missense unknown
R0433:Spen UTSW 4 141,211,069 (GRCm39) missense unknown
R0462:Spen UTSW 4 141,200,962 (GRCm39) missense probably damaging 1.00
R0687:Spen UTSW 4 141,215,339 (GRCm39) missense unknown
R0699:Spen UTSW 4 141,201,702 (GRCm39) missense possibly damaging 0.72
R0865:Spen UTSW 4 141,199,181 (GRCm39) missense probably benign 0.11
R0918:Spen UTSW 4 141,212,875 (GRCm39) missense unknown
R1034:Spen UTSW 4 141,203,063 (GRCm39) missense probably benign 0.33
R1341:Spen UTSW 4 141,196,711 (GRCm39) missense possibly damaging 0.78
R1401:Spen UTSW 4 141,199,132 (GRCm39) missense probably damaging 0.98
R1509:Spen UTSW 4 141,202,946 (GRCm39) missense probably benign 0.00
R1509:Spen UTSW 4 141,203,011 (GRCm39) missense possibly damaging 0.53
R1561:Spen UTSW 4 141,199,694 (GRCm39) nonsense probably null
R1589:Spen UTSW 4 141,215,335 (GRCm39) missense unknown
R1640:Spen UTSW 4 141,196,254 (GRCm39) missense probably damaging 0.98
R1758:Spen UTSW 4 141,203,686 (GRCm39) missense unknown
R1764:Spen UTSW 4 141,200,261 (GRCm39) missense probably damaging 1.00
R1824:Spen UTSW 4 141,200,096 (GRCm39) missense probably damaging 1.00
R1899:Spen UTSW 4 141,197,654 (GRCm39) missense probably benign 0.17
R1916:Spen UTSW 4 141,199,909 (GRCm39) missense probably damaging 1.00
R2011:Spen UTSW 4 141,200,640 (GRCm39) missense probably damaging 1.00
R2295:Spen UTSW 4 141,204,584 (GRCm39) missense unknown
R2379:Spen UTSW 4 141,244,238 (GRCm39) missense unknown
R2404:Spen UTSW 4 141,205,216 (GRCm39) missense unknown
R3719:Spen UTSW 4 141,244,494 (GRCm39) missense unknown
R3889:Spen UTSW 4 141,205,192 (GRCm39) missense unknown
R3945:Spen UTSW 4 141,204,664 (GRCm39) missense unknown
R4227:Spen UTSW 4 141,249,458 (GRCm39) missense unknown
R4326:Spen UTSW 4 141,204,683 (GRCm39) missense unknown
R4382:Spen UTSW 4 141,200,450 (GRCm39) missense possibly damaging 0.88
R4542:Spen UTSW 4 141,204,097 (GRCm39) missense unknown
R4757:Spen UTSW 4 141,200,390 (GRCm39) nonsense probably null
R4771:Spen UTSW 4 141,199,907 (GRCm39) missense probably benign 0.14
R5072:Spen UTSW 4 141,249,613 (GRCm39) missense unknown
R5121:Spen UTSW 4 141,203,410 (GRCm39) missense probably benign 0.00
R5176:Spen UTSW 4 141,203,587 (GRCm39) missense unknown
R5290:Spen UTSW 4 141,201,127 (GRCm39) missense probably damaging 1.00
R5291:Spen UTSW 4 141,215,390 (GRCm39) missense unknown
R5293:Spen UTSW 4 141,199,717 (GRCm39) missense possibly damaging 0.89
R5347:Spen UTSW 4 141,198,796 (GRCm39) missense probably benign 0.26
R5511:Spen UTSW 4 141,244,149 (GRCm39) missense unknown
R5511:Spen UTSW 4 141,202,375 (GRCm39) missense possibly damaging 0.86
R5772:Spen UTSW 4 141,205,495 (GRCm39) missense unknown
R5834:Spen UTSW 4 141,199,154 (GRCm39) missense possibly damaging 0.63
R5858:Spen UTSW 4 141,201,182 (GRCm39) missense probably benign 0.05
R6214:Spen UTSW 4 141,206,423 (GRCm39) missense unknown
R6232:Spen UTSW 4 141,244,333 (GRCm39) missense unknown
R6345:Spen UTSW 4 141,198,944 (GRCm39) missense possibly damaging 0.86
R6419:Spen UTSW 4 141,203,621 (GRCm39) missense unknown
R6455:Spen UTSW 4 141,202,820 (GRCm39) missense probably damaging 0.97
R6979:Spen UTSW 4 141,205,374 (GRCm39) missense unknown
R6994:Spen UTSW 4 141,220,770 (GRCm39) missense unknown
R7018:Spen UTSW 4 141,220,755 (GRCm39) missense unknown
R7040:Spen UTSW 4 141,221,693 (GRCm39) missense unknown
R7127:Spen UTSW 4 141,203,419 (GRCm39) missense possibly damaging 0.53
R7218:Spen UTSW 4 141,199,961 (GRCm39) missense possibly damaging 0.54
R7234:Spen UTSW 4 141,206,446 (GRCm39) missense unknown
R7316:Spen UTSW 4 141,204,365 (GRCm39) missense unknown
R7350:Spen UTSW 4 141,206,696 (GRCm39) missense unknown
R7400:Spen UTSW 4 141,201,052 (GRCm39) missense probably damaging 1.00
R7470:Spen UTSW 4 141,206,605 (GRCm39) missense unknown
R7698:Spen UTSW 4 141,200,156 (GRCm39) missense probably damaging 1.00
R7858:Spen UTSW 4 141,215,442 (GRCm39) splice site probably null
R8033:Spen UTSW 4 141,199,057 (GRCm39) missense probably benign 0.03
R8064:Spen UTSW 4 141,203,011 (GRCm39) missense possibly damaging 0.53
R8159:Spen UTSW 4 141,202,314 (GRCm39) missense possibly damaging 0.53
R8187:Spen UTSW 4 141,200,216 (GRCm39) missense possibly damaging 0.93
R8463:Spen UTSW 4 141,249,590 (GRCm39) missense unknown
R8557:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8558:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8672:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8673:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8674:Spen UTSW 4 141,197,681 (GRCm39) missense probably benign 0.14
R8714:Spen UTSW 4 141,215,314 (GRCm39) missense unknown
R8735:Spen UTSW 4 141,197,129 (GRCm39) missense probably benign 0.32
R8762:Spen UTSW 4 141,200,261 (GRCm39) missense probably damaging 1.00
R8877:Spen UTSW 4 141,199,137 (GRCm39) nonsense probably null
R8878:Spen UTSW 4 141,204,520 (GRCm39) missense unknown
R8937:Spen UTSW 4 141,201,374 (GRCm39) missense probably damaging 1.00
R8939:Spen UTSW 4 141,202,969 (GRCm39) missense possibly damaging 0.72
R8968:Spen UTSW 4 141,197,701 (GRCm39) missense probably benign 0.02
R8971:Spen UTSW 4 141,201,889 (GRCm39) missense possibly damaging 0.53
R9016:Spen UTSW 4 141,200,938 (GRCm39) missense probably damaging 1.00
R9072:Spen UTSW 4 141,203,702 (GRCm39) missense unknown
R9073:Spen UTSW 4 141,203,702 (GRCm39) missense unknown
R9120:Spen UTSW 4 141,200,233 (GRCm39) missense
R9136:Spen UTSW 4 141,249,623 (GRCm39) missense unknown
R9138:Spen UTSW 4 141,196,797 (GRCm39) missense probably damaging 1.00
R9150:Spen UTSW 4 141,244,468 (GRCm39) missense unknown
R9225:Spen UTSW 4 141,202,943 (GRCm39) missense possibly damaging 0.53
R9492:Spen UTSW 4 141,199,098 (GRCm39) missense probably benign 0.26
R9537:Spen UTSW 4 141,244,156 (GRCm39) small deletion probably benign
R9537:Spen UTSW 4 141,199,015 (GRCm39) missense probably benign 0.15
R9602:Spen UTSW 4 141,205,183 (GRCm39) missense unknown
R9609:Spen UTSW 4 141,215,419 (GRCm39) missense unknown
R9686:Spen UTSW 4 141,199,946 (GRCm39) missense probably benign 0.27
R9697:Spen UTSW 4 141,196,275 (GRCm39) missense probably damaging 1.00
R9713:Spen UTSW 4 141,244,331 (GRCm39) missense unknown
T0722:Spen UTSW 4 141,201,664 (GRCm39) missense probably benign 0.33
T0975:Spen UTSW 4 141,201,664 (GRCm39) missense probably benign 0.33
Z1088:Spen UTSW 4 141,205,288 (GRCm39) missense unknown
Z1088:Spen UTSW 4 141,205,287 (GRCm39) missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-09-13