Incidental Mutation 'R7356:Usp42'
ID570952
Institutional Source Beutler Lab
Gene Symbol Usp42
Ensembl Gene ENSMUSG00000051306
Gene Nameubiquitin specific peptidase 42
SynonymsA630018G05Rik, D5Ertd591e, 3110031A07Rik, 2410140K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7356 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location143710325-143732280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143717087 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 593 (V593A)
Ref Sequence ENSEMBL: ENSMUSP00000053955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053287]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053287
AA Change: V593A

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053955
Gene: ENSMUSG00000051306
AA Change: V593A

DomainStartEndE-ValueType
low complexity region 65 77 N/A INTRINSIC
Pfam:UCH 109 408 1.4e-46 PFAM
Pfam:UCH_1 110 391 1.4e-18 PFAM
low complexity region 470 490 N/A INTRINSIC
low complexity region 567 579 N/A INTRINSIC
low complexity region 604 613 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 954 962 N/A INTRINSIC
low complexity region 1016 1031 N/A INTRINSIC
low complexity region 1201 1219 N/A INTRINSIC
low complexity region 1239 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit fecundity and behavioral abnormalities, hyperactivity, increased T cell number, abnormal lens morphology, and cataracts. Males display oligozoospermia and testis degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A T 4: 49,383,507 D15E probably damaging Het
Adamts16 G A 13: 70,836,280 T88I probably benign Het
Akap6 A C 12: 52,911,864 N801H probably damaging Het
Ankfn1 G T 11: 89,434,773 N524K probably damaging Het
Ap5s1 A G 2: 131,212,662 N131S probably damaging Het
Astn2 A T 4: 66,185,266 D303E unknown Het
Babam1 T C 8: 71,399,564 V132A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC 3: 95,888,141 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGCTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,158 probably benign Het
BC028528 GGTCACTGGTTCTGT GGTCACTGGTTCTGTAGTCACTGGTTCTGT 3: 95,888,165 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTCCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
BC028528 CACTGGTT CACTGGTTCTATGGTGACTGGTT 3: 95,888,183 probably benign Het
Cnst C T 1: 179,606,530 P304S probably benign Het
Cog4 A T 8: 110,849,866 probably null Het
Cyp2j13 A T 4: 96,077,418 H17Q probably benign Het
Ddx58 A G 4: 40,226,600 S231P probably benign Het
Dock6 G A 9: 21,809,899 T1662I probably damaging Het
Dysf T C 6: 84,067,461 F270S probably damaging Het
Erbb4 A G 1: 68,339,355 probably null Het
Fam120b A T 17: 15,407,696 Q550L probably benign Het
Fam83b A T 9: 76,492,853 F323I probably benign Het
Far1 T A 7: 113,568,142 I478N possibly damaging Het
Gdpd5 T A 7: 99,458,878 I554N probably damaging Het
Glrx3 T C 7: 137,452,724 S79P probably damaging Het
Hltf T C 3: 20,109,370 I888T probably damaging Het
Hpx A G 7: 105,591,710 V452A probably damaging Het
Itk T G 11: 46,367,832 Q81P possibly damaging Het
Kdm6b G A 11: 69,402,165 Q1262* probably null Het
Lpcat2 T C 8: 92,864,983 V85A probably benign Het
Lrrk2 A T 15: 91,738,744 H1039L probably benign Het
Mapk3 T C 7: 126,760,915 probably null Het
Masp1 A T 16: 23,470,243 N602K possibly damaging Het
Myo7a T A 7: 98,102,683 Q40L probably benign Het
Nek1 A T 8: 61,120,960 M1081L probably benign Het
Nes T C 3: 87,977,751 S1106P possibly damaging Het
Nkpd1 A T 7: 19,523,774 I493F probably damaging Het
Npsr1 C G 9: 24,098,261 S21C probably benign Het
Olfr1001-ps1 G A 2: 85,633,438 R3K probably benign Het
Olfr175-ps1 A T 16: 58,824,355 M118K probably damaging Het
Olfr738 G A 14: 50,413,702 V53M probably damaging Het
Oog1 G A 12: 87,606,277 probably null Het
Osbpl9 G T 4: 109,068,480 Y340* probably null Het
Pcyox1l A T 18: 61,707,550 L11Q probably null Het
Pdxdc1 G A 16: 13,860,003 R255C probably damaging Het
Pgap1 A G 1: 54,530,134 S358P probably benign Het
Pgm2l1 A G 7: 100,268,119 Y481C possibly damaging Het
Plekhf1 T C 7: 38,222,121 T8A possibly damaging Het
Plg G T 17: 12,410,911 G611C probably damaging Het
Prf1 A C 10: 61,303,280 D339A possibly damaging Het
Prph A G 15: 99,056,926 Y291C probably damaging Het
Rasal1 A G 5: 120,654,825 S48G possibly damaging Het
Ripk4 T A 16: 97,743,149 Q766L probably damaging Het
Scaf1 T C 7: 45,007,784 D557G unknown Het
Scaper A T 9: 55,892,211 M190K unknown Het
Scn8a A T 15: 100,957,579 I202F probably damaging Het
Siglecf A G 7: 43,356,431 I505V probably benign Het
Sirpb1c A G 3: 15,832,133 S360P probably benign Het
Sla2 C A 2: 156,878,703 probably null Het
Slc11a1 G T 1: 74,385,489 V544L probably benign Het
Slco1a5 T A 6: 142,234,732 K648I probably benign Het
Sorcs1 T A 19: 50,175,157 I1020F possibly damaging Het
Spen C A 4: 141,471,924 E3131* probably null Het
Sult2a7 A T 7: 14,477,106 W162R probably damaging Het
Sult3a1 G A 10: 33,866,583 E69K probably benign Het
Tcof1 G T 18: 60,818,094 D1119E unknown Het
Tom1l2 A T 11: 60,249,027 I272K probably damaging Het
Tspan5 C T 3: 138,742,432 probably benign Het
Ttn A G 2: 76,867,900 L186P Het
Uap1l1 T C 2: 25,361,684 E496G possibly damaging Het
Ube2v1 A T 2: 167,609,195 I117N possibly damaging Het
Virma T A 4: 11,513,595 I483N probably damaging Het
Vwde T A 6: 13,192,642 I421F probably damaging Het
Zfp345 G A 2: 150,472,289 H443Y probably damaging Het
Zfp760 A G 17: 21,722,620 T259A probably benign Het
Zfp941 T C 7: 140,812,115 I444V possibly damaging Het
Zfyve9 A C 4: 108,719,015 S290A probably benign Het
Other mutations in Usp42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Usp42 APN 5 143717142 missense probably benign 0.00
IGL00902:Usp42 APN 5 143719874 splice site probably benign
IGL01326:Usp42 APN 5 143721215 missense possibly damaging 0.54
IGL01985:Usp42 APN 5 143715185 missense probably damaging 1.00
IGL02629:Usp42 APN 5 143723154 missense possibly damaging 0.94
IGL02683:Usp42 APN 5 143715346 missense possibly damaging 0.55
IGL02700:Usp42 APN 5 143717128 missense probably benign 0.01
IGL02965:Usp42 APN 5 143728014 missense probably damaging 1.00
PIT4468001:Usp42 UTSW 5 143714644 missense probably damaging 1.00
R0043:Usp42 UTSW 5 143714710 missense probably benign 0.09
R0043:Usp42 UTSW 5 143714710 missense probably benign 0.09
R0420:Usp42 UTSW 5 143714861 missense probably damaging 0.99
R1066:Usp42 UTSW 5 143718041 missense probably damaging 1.00
R1345:Usp42 UTSW 5 143717333 missense probably damaging 1.00
R1628:Usp42 UTSW 5 143717367 missense probably damaging 1.00
R1728:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1729:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1767:Usp42 UTSW 5 143714866 missense possibly damaging 0.69
R1772:Usp42 UTSW 5 143717102 missense probably damaging 1.00
R1784:Usp42 UTSW 5 143714626 missense probably damaging 1.00
R1916:Usp42 UTSW 5 143715056 missense probably damaging 1.00
R2425:Usp42 UTSW 5 143715839 missense probably benign 0.09
R2867:Usp42 UTSW 5 143715464 missense possibly damaging 0.52
R2867:Usp42 UTSW 5 143715464 missense possibly damaging 0.52
R2886:Usp42 UTSW 5 143721629 splice site probably benign
R3195:Usp42 UTSW 5 143717199 missense probably benign 0.02
R3737:Usp42 UTSW 5 143715439 missense probably benign 0.00
R3738:Usp42 UTSW 5 143715439 missense probably benign 0.00
R4034:Usp42 UTSW 5 143715439 missense probably benign 0.00
R4795:Usp42 UTSW 5 143723937 missense probably damaging 1.00
R4940:Usp42 UTSW 5 143719762 missense probably damaging 1.00
R4967:Usp42 UTSW 5 143715364 missense possibly damaging 0.71
R5282:Usp42 UTSW 5 143721646 missense probably damaging 1.00
R5773:Usp42 UTSW 5 143713712 missense probably benign 0.03
R5778:Usp42 UTSW 5 143719576 missense probably damaging 1.00
R5933:Usp42 UTSW 5 143715515 missense probably benign 0.00
R6192:Usp42 UTSW 5 143717187 missense possibly damaging 0.73
R6275:Usp42 UTSW 5 143714972 missense probably damaging 1.00
R6496:Usp42 UTSW 5 143715103 missense probably damaging 1.00
R6825:Usp42 UTSW 5 143727807 missense probably damaging 1.00
R6939:Usp42 UTSW 5 143727969 missense probably damaging 1.00
R7099:Usp42 UTSW 5 143726645 missense probably damaging 1.00
R7876:Usp42 UTSW 5 143721671 missense probably damaging 1.00
R7959:Usp42 UTSW 5 143721671 missense probably damaging 1.00
X0022:Usp42 UTSW 5 143716060 frame shift probably null
X0027:Usp42 UTSW 5 143717078 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTAGCACCATTTAGCAGGACG -3'
(R):5'- TTCACAACAAGTTGCCTGCTC -3'

Sequencing Primer
(F):5'- ACCATTTAGCAGGACGGGTTC -3'
(R):5'- AAGTTGCCTGCTCGCCAG -3'
Posted On2019-09-13