Incidental Mutation 'R7356:Akap6'
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene NameA kinase (PRKA) anchor protein 6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R7356 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location52699383-53155599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 52911864 bp
Amino Acid Change Asparagine to Histidine at position 801 (N801H)
Ref Sequence ENSEMBL: ENSMUSP00000093406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
Predicted Effect probably damaging
Transcript: ENSMUST00000095737
AA Change: N801H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: N801H

low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219786
AA Change: N801H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A T 4: 49,383,507 D15E probably damaging Het
Adamts16 G A 13: 70,836,280 T88I probably benign Het
Ankfn1 G T 11: 89,434,773 N524K probably damaging Het
Ap5s1 A G 2: 131,212,662 N131S probably damaging Het
Astn2 A T 4: 66,185,266 D303E unknown Het
Babam1 T C 8: 71,399,564 V132A probably benign Het
BC028528 CACTGGTT CACTGGTTCTATGGTGACTGGTT 3: 95,888,183 probably benign Het
Cnst C T 1: 179,606,530 P304S probably benign Het
Cog4 A T 8: 110,849,866 probably null Het
Cyp2j13 A T 4: 96,077,418 H17Q probably benign Het
Ddx58 A G 4: 40,226,600 S231P probably benign Het
Dock6 G A 9: 21,809,899 T1662I probably damaging Het
Dysf T C 6: 84,067,461 F270S probably damaging Het
Erbb4 A G 1: 68,339,355 probably null Het
Fam120b A T 17: 15,407,696 Q550L probably benign Het
Fam83b A T 9: 76,492,853 F323I probably benign Het
Far1 T A 7: 113,568,142 I478N possibly damaging Het
Gdpd5 T A 7: 99,458,878 I554N probably damaging Het
Glrx3 T C 7: 137,452,724 S79P probably damaging Het
Hltf T C 3: 20,109,370 I888T probably damaging Het
Hpx A G 7: 105,591,710 V452A probably damaging Het
Itk T G 11: 46,367,832 Q81P possibly damaging Het
Kdm6b G A 11: 69,402,165 Q1262* probably null Het
Lpcat2 T C 8: 92,864,983 V85A probably benign Het
Lrrk2 A T 15: 91,738,744 H1039L probably benign Het
Mapk3 T C 7: 126,760,915 probably null Het
Masp1 A T 16: 23,470,243 N602K possibly damaging Het
Myo7a T A 7: 98,102,683 Q40L probably benign Het
Nek1 A T 8: 61,120,960 M1081L probably benign Het
Nes T C 3: 87,977,751 S1106P possibly damaging Het
Nkpd1 A T 7: 19,523,774 I493F probably damaging Het
Npsr1 C G 9: 24,098,261 S21C probably benign Het
Olfr1001-ps1 G A 2: 85,633,438 R3K probably benign Het
Olfr175-ps1 A T 16: 58,824,355 M118K probably damaging Het
Olfr738 G A 14: 50,413,702 V53M probably damaging Het
Oog1 G A 12: 87,606,277 probably null Het
Osbpl9 G T 4: 109,068,480 Y340* probably null Het
Pcyox1l A T 18: 61,707,550 L11Q probably null Het
Pdxdc1 G A 16: 13,860,003 R255C probably damaging Het
Pgap1 A G 1: 54,530,134 S358P probably benign Het
Pgm2l1 A G 7: 100,268,119 Y481C possibly damaging Het
Plekhf1 T C 7: 38,222,121 T8A possibly damaging Het
Plg G T 17: 12,410,911 G611C probably damaging Het
Prf1 A C 10: 61,303,280 D339A possibly damaging Het
Prph A G 15: 99,056,926 Y291C probably damaging Het
Rasal1 A G 5: 120,654,825 S48G possibly damaging Het
Ripk4 T A 16: 97,743,149 Q766L probably damaging Het
Scaf1 T C 7: 45,007,784 D557G unknown Het
Scaper A T 9: 55,892,211 M190K unknown Het
Scn8a A T 15: 100,957,579 I202F probably damaging Het
Siglecf A G 7: 43,356,431 I505V probably benign Het
Sirpb1c A G 3: 15,832,133 S360P probably benign Het
Sla2 C A 2: 156,878,703 probably null Het
Slc11a1 G T 1: 74,385,489 V544L probably benign Het
Slco1a5 T A 6: 142,234,732 K648I probably benign Het
Sorcs1 T A 19: 50,175,157 I1020F possibly damaging Het
Spen C A 4: 141,471,924 E3131* probably null Het
Sult2a7 A T 7: 14,477,106 W162R probably damaging Het
Sult3a1 G A 10: 33,866,583 E69K probably benign Het
Tcof1 G T 18: 60,818,094 D1119E unknown Het
Tom1l2 A T 11: 60,249,027 I272K probably damaging Het
Tspan5 C T 3: 138,742,432 probably benign Het
Ttn A G 2: 76,867,900 L186P Het
Uap1l1 T C 2: 25,361,684 E496G possibly damaging Het
Ube2v1 A T 2: 167,609,195 I117N possibly damaging Het
Usp42 A G 5: 143,717,087 V593A possibly damaging Het
Virma T A 4: 11,513,595 I483N probably damaging Het
Vwde T A 6: 13,192,642 I421F probably damaging Het
Zfp345 G A 2: 150,472,289 H443Y probably damaging Het
Zfp760 A G 17: 21,722,620 T259A probably benign Het
Zfp941 T C 7: 140,812,115 I444V possibly damaging Het
Zfyve9 A C 4: 108,719,015 S290A probably benign Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0632:Akap6 UTSW 12 52937148 missense probably damaging 1.00
R0666:Akap6 UTSW 12 52911808 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53069222 missense probably damaging 0.97
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1512:Akap6 UTSW 12 52937154 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3783:Akap6 UTSW 12 52880769 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4513:Akap6 UTSW 12 52796004 missense probably benign 0.03
R4686:Akap6 UTSW 12 52887623 frame shift probably null
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5116:Akap6 UTSW 12 53141515 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5225:Akap6 UTSW 12 52886546 missense probably damaging 1.00
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
R7142:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7143:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7216:Akap6 UTSW 12 53140457 missense probably benign 0.02
R7297:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7378:Akap6 UTSW 12 53142574 missense probably benign 0.00
R7382:Akap6 UTSW 12 53142171 missense probably benign 0.00
R7498:Akap6 UTSW 12 53142705 nonsense probably null
R7542:Akap6 UTSW 12 53069234 missense probably damaging 1.00
R7589:Akap6 UTSW 12 53142063 nonsense probably null
R7676:Akap6 UTSW 12 52886850 missense possibly damaging 0.94
R7814:Akap6 UTSW 12 53140961 missense probably benign 0.28
R7971:Akap6 UTSW 12 53139795 missense probably damaging 1.00
R8039:Akap6 UTSW 12 53141676 missense probably benign 0.00
R8425:Akap6 UTSW 12 52886621 missense probably benign 0.00
R8747:Akap6 UTSW 12 53142216 missense probably benign 0.01
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Z1176:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-09-13