Incidental Mutation 'R7356:Fam120b'
ID570995
Institutional Source Beutler Lab
Gene Symbol Fam120b
Ensembl Gene ENSMUSG00000014763
Gene Namefamily with sequence similarity 120, member B
SynonymsCCPG, 4932442K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7356 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location15396202-15433583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15407696 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 550 (Q550L)
Ref Sequence ENSEMBL: ENSMUSP00000054420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055352]
Predicted Effect probably benign
Transcript: ENSMUST00000055352
AA Change: Q550L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000054420
Gene: ENSMUSG00000014763
AA Change: Q550L

DomainStartEndE-ValueType
Blast:XPGN 1 111 7e-46 BLAST
SCOP:d1a77_2 21 185 6e-8 SMART
internal_repeat_1 324 364 9.23e-10 PROSPERO
internal_repeat_1 372 412 9.23e-10 PROSPERO
low complexity region 650 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 A T 4: 49,383,507 D15E probably damaging Het
Adamts16 G A 13: 70,836,280 T88I probably benign Het
Akap6 A C 12: 52,911,864 N801H probably damaging Het
Ankfn1 G T 11: 89,434,773 N524K probably damaging Het
Ap5s1 A G 2: 131,212,662 N131S probably damaging Het
Astn2 A T 4: 66,185,266 D303E unknown Het
Babam1 T C 8: 71,399,564 V132A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC 3: 95,888,141 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGCTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,158 probably benign Het
BC028528 GGTCACTGGTTCTGT GGTCACTGGTTCTGTAGTCACTGGTTCTGT 3: 95,888,165 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTCCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
BC028528 CACTGGTT CACTGGTTCTATGGTGACTGGTT 3: 95,888,183 probably benign Het
Cnst C T 1: 179,606,530 P304S probably benign Het
Cog4 A T 8: 110,849,866 probably null Het
Cyp2j13 A T 4: 96,077,418 H17Q probably benign Het
Ddx58 A G 4: 40,226,600 S231P probably benign Het
Dock6 G A 9: 21,809,899 T1662I probably damaging Het
Dysf T C 6: 84,067,461 F270S probably damaging Het
Erbb4 A G 1: 68,339,355 probably null Het
Fam83b A T 9: 76,492,853 F323I probably benign Het
Far1 T A 7: 113,568,142 I478N possibly damaging Het
Gdpd5 T A 7: 99,458,878 I554N probably damaging Het
Glrx3 T C 7: 137,452,724 S79P probably damaging Het
Hltf T C 3: 20,109,370 I888T probably damaging Het
Hpx A G 7: 105,591,710 V452A probably damaging Het
Itk T G 11: 46,367,832 Q81P possibly damaging Het
Kdm6b G A 11: 69,402,165 Q1262* probably null Het
Lpcat2 T C 8: 92,864,983 V85A probably benign Het
Lrrk2 A T 15: 91,738,744 H1039L probably benign Het
Mapk3 T C 7: 126,760,915 probably null Het
Masp1 A T 16: 23,470,243 N602K possibly damaging Het
Myo7a T A 7: 98,102,683 Q40L probably benign Het
Nek1 A T 8: 61,120,960 M1081L probably benign Het
Nes T C 3: 87,977,751 S1106P possibly damaging Het
Nkpd1 A T 7: 19,523,774 I493F probably damaging Het
Npsr1 C G 9: 24,098,261 S21C probably benign Het
Olfr1001-ps1 G A 2: 85,633,438 R3K probably benign Het
Olfr175-ps1 A T 16: 58,824,355 M118K probably damaging Het
Olfr738 G A 14: 50,413,702 V53M probably damaging Het
Oog1 G A 12: 87,606,277 probably null Het
Osbpl9 G T 4: 109,068,480 Y340* probably null Het
Pcyox1l A T 18: 61,707,550 L11Q probably null Het
Pdxdc1 G A 16: 13,860,003 R255C probably damaging Het
Pgap1 A G 1: 54,530,134 S358P probably benign Het
Pgm2l1 A G 7: 100,268,119 Y481C possibly damaging Het
Plekhf1 T C 7: 38,222,121 T8A possibly damaging Het
Plg G T 17: 12,410,911 G611C probably damaging Het
Prf1 A C 10: 61,303,280 D339A possibly damaging Het
Prph A G 15: 99,056,926 Y291C probably damaging Het
Rasal1 A G 5: 120,654,825 S48G possibly damaging Het
Ripk4 T A 16: 97,743,149 Q766L probably damaging Het
Scaf1 T C 7: 45,007,784 D557G unknown Het
Scaper A T 9: 55,892,211 M190K unknown Het
Scn8a A T 15: 100,957,579 I202F probably damaging Het
Siglecf A G 7: 43,356,431 I505V probably benign Het
Sirpb1c A G 3: 15,832,133 S360P probably benign Het
Sla2 C A 2: 156,878,703 probably null Het
Slc11a1 G T 1: 74,385,489 V544L probably benign Het
Slco1a5 T A 6: 142,234,732 K648I probably benign Het
Sorcs1 T A 19: 50,175,157 I1020F possibly damaging Het
Spen C A 4: 141,471,924 E3131* probably null Het
Sult2a7 A T 7: 14,477,106 W162R probably damaging Het
Sult3a1 G A 10: 33,866,583 E69K probably benign Het
Tcof1 G T 18: 60,818,094 D1119E unknown Het
Tom1l2 A T 11: 60,249,027 I272K probably damaging Het
Tspan5 C T 3: 138,742,432 probably benign Het
Ttn A G 2: 76,867,900 L186P Het
Uap1l1 T C 2: 25,361,684 E496G possibly damaging Het
Ube2v1 A T 2: 167,609,195 I117N possibly damaging Het
Usp42 A G 5: 143,717,087 V593A possibly damaging Het
Virma T A 4: 11,513,595 I483N probably damaging Het
Vwde T A 6: 13,192,642 I421F probably damaging Het
Zfp345 G A 2: 150,472,289 H443Y probably damaging Het
Zfp760 A G 17: 21,722,620 T259A probably benign Het
Zfp941 T C 7: 140,812,115 I444V possibly damaging Het
Zfyve9 A C 4: 108,719,015 S290A probably benign Het
Other mutations in Fam120b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam120b APN 17 15402595 nonsense probably null
IGL01874:Fam120b APN 17 15403039 nonsense probably null
IGL02111:Fam120b APN 17 15402585 missense possibly damaging 0.67
IGL02395:Fam120b APN 17 15402515 missense probably damaging 1.00
IGL02901:Fam120b APN 17 15407702 splice site probably benign
IGL03380:Fam120b APN 17 15403134 splice site probably benign
R0139:Fam120b UTSW 17 15426184 splice site probably benign
R0242:Fam120b UTSW 17 15422924 missense probably damaging 1.00
R0242:Fam120b UTSW 17 15422924 missense probably damaging 1.00
R0244:Fam120b UTSW 17 15417637 missense probably damaging 1.00
R0486:Fam120b UTSW 17 15426288 splice site probably benign
R0551:Fam120b UTSW 17 15431643 splice site probably benign
R0584:Fam120b UTSW 17 15402122 missense probably damaging 1.00
R0620:Fam120b UTSW 17 15402927 missense probably benign
R1606:Fam120b UTSW 17 15401811 missense possibly damaging 0.79
R1638:Fam120b UTSW 17 15402497 missense possibly damaging 0.95
R2022:Fam120b UTSW 17 15424376 missense possibly damaging 0.70
R3411:Fam120b UTSW 17 15431635 splice site probably benign
R4422:Fam120b UTSW 17 15402183 missense probably damaging 1.00
R4754:Fam120b UTSW 17 15422962 missense probably damaging 1.00
R4756:Fam120b UTSW 17 15402396 missense probably damaging 1.00
R4883:Fam120b UTSW 17 15403032 missense probably benign
R5400:Fam120b UTSW 17 15403126 missense possibly damaging 0.55
R5418:Fam120b UTSW 17 15401799 missense probably damaging 1.00
R5632:Fam120b UTSW 17 15403082 missense probably benign 0.08
R5878:Fam120b UTSW 17 15402240 missense probably damaging 1.00
R6030:Fam120b UTSW 17 15401910 missense probably damaging 1.00
R6030:Fam120b UTSW 17 15401910 missense probably damaging 1.00
R6846:Fam120b UTSW 17 15414829 missense probably damaging 1.00
R6929:Fam120b UTSW 17 15423028 missense possibly damaging 0.78
R7616:Fam120b UTSW 17 15402836 missense possibly damaging 0.79
R7848:Fam120b UTSW 17 15405774 missense possibly damaging 0.93
R7931:Fam120b UTSW 17 15405774 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCACAAGGCCAATGGTGTG -3'
(R):5'- CTTTCAGGGCACAGGAATTAAAAG -3'

Sequencing Primer
(F):5'- GCAAGGACTTTGTGTTCCAC -3'
(R):5'- CCTTCGGATCAAGGTGTAGAACTC -3'
Posted On2019-09-13