Incidental Mutation 'R7357:Rabgap1l'
ID571003
Institutional Source Beutler Lab
Gene Symbol Rabgap1l
Ensembl Gene ENSMUSG00000026721
Gene NameRAB GTPase activating protein 1-like
SynonymsHh1, 8430421H08Rik, 5830411O09Rik, 9630005B12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7357 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location160219174-160793211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160342038 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 780 (K780E)
Ref Sequence ENSEMBL: ENSMUSP00000028049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028049] [ENSMUST00000028052] [ENSMUST00000191651]
Predicted Effect probably damaging
Transcript: ENSMUST00000028049
AA Change: K780E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028049
Gene: ENSMUSG00000026721
AA Change: K780E

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
PTB 127 260 4.47e-20 SMART
Pfam:DUF3694 290 421 8.1e-41 PFAM
low complexity region 483 496 N/A INTRINSIC
TBC 535 747 5.13e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000028052
AA Change: K99E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028052
Gene: ENSMUSG00000026721
AA Change: K99E

DomainStartEndE-ValueType
Blast:TBC 54 100 8e-16 BLAST
PDB:3HZJ|C 54 130 9e-35 PDB
Blast:TBC 113 176 2e-24 BLAST
low complexity region 188 200 N/A INTRINSIC
coiled coil region 281 340 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191651
AA Change: K72E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141357
Gene: ENSMUSG00000026721
AA Change: K72E

DomainStartEndE-ValueType
PDB:3HZJ|C 1 107 1e-71 PDB
SCOP:d1fkma2 1 107 1e-9 SMART
Blast:TBC 13 89 2e-32 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion are viable, fertile and overtly normal with no alterations in hematopoietic progenitor cell numbers or types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A T 2: 156,003,867 H23Q unknown Het
9530068E07Rik A T 11: 52,406,994 K233I probably damaging Het
Aldh1l2 T C 10: 83,514,544 M320V possibly damaging Het
C2cd3 A G 7: 100,430,103 N838S Het
Cacna1s T C 1: 136,071,021 F218S probably damaging Het
Carmil3 G T 14: 55,491,133 probably benign Het
Cd300a A T 11: 114,893,327 T54S probably benign Het
Celf3 G A 3: 94,480,330 E70K probably damaging Het
Celsr1 A C 15: 86,030,514 M1086R probably benign Het
Ces2f G A 8: 104,949,963 M96I probably benign Het
Chrdl2 G A 7: 100,029,207 V329I probably benign Het
Ctc1 T A 11: 69,034,742 L1035Q probably benign Het
Dbi A G 1: 120,119,893 probably null Het
Dock3 A G 9: 107,005,369 I405T probably benign Het
Dpp4 A T 2: 62,387,077 W59R probably benign Het
Dsg3 T A 18: 20,539,783 I837N probably damaging Het
Fbxw15 A G 9: 109,558,240 V229A probably benign Het
Fermt3 T C 19: 7,002,843 T395A probably benign Het
Focad A T 4: 88,229,335 I404F probably benign Het
Gm4869 A G 5: 140,495,051 R979G possibly damaging Het
Gm8104 T C 14: 43,101,611 I86T probably damaging Het
Gm9857 A C 3: 108,940,162 L95R unknown Het
Hoxa1 A T 6: 52,156,949 S266T probably benign Het
Leng8 T A 7: 4,144,933 Y625* probably null Het
Mast3 A G 8: 70,784,859 V557A probably damaging Het
Morc1 T C 16: 48,622,590 F813L probably benign Het
Ntf3 T A 6: 126,101,998 I182F probably damaging Het
Nup153 G T 13: 46,717,166 A91E probably benign Het
Olfr1402 G C 3: 97,410,655 N175K probably damaging Het
Olfr648 A T 7: 104,179,771 D212E probably damaging Het
Pamr1 G A 2: 102,586,704 W120* probably null Het
Pcsk1 A G 13: 75,125,960 N436S probably damaging Het
Pde4dip T C 3: 97,715,541 K1451E probably benign Het
Pebp4 G A 14: 70,048,415 V176I possibly damaging Het
Phgdh G A 3: 98,339,822 A4V probably benign Het
Pik3c2g T C 6: 139,633,793 probably null Het
Ppic T C 18: 53,411,067 Y82C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ppp1r9b T C 11: 95,004,598 V704A probably benign Het
Pramel6 G T 2: 87,510,512 R396L not run Het
Prss48 A T 3: 85,997,221 D223E probably damaging Het
Psd3 T C 8: 68,121,497 K11E probably benign Het
Retreg1 A T 15: 25,971,943 D323V probably damaging Het
Samd11 A T 4: 156,255,007 probably null Het
Sec14l3 T A 11: 4,070,127 F188Y probably benign Het
Serpina5 A T 12: 104,103,380 T284S possibly damaging Het
Setx A G 2: 29,130,301 D100G probably benign Het
Sis A T 3: 72,925,071 V1035D probably damaging Het
Slco4a1 A G 2: 180,472,137 I456V probably benign Het
Snx14 A T 9: 88,404,316 C393S possibly damaging Het
Stil T C 4: 115,014,226 probably null Het
Sult6b1 A G 17: 78,894,630 S148P probably damaging Het
Sycp2 G T 2: 178,403,804 probably null Het
Tesmin T C 19: 3,397,042 I273T probably benign Het
Tmem39a T A 16: 38,586,230 Y310N probably damaging Het
Trp53bp1 A T 2: 121,211,300 D1258E probably damaging Het
Ttc12 A C 9: 49,438,387 D703E probably benign Het
Unc13c TATAA TATAATAA 9: 73,933,528 probably benign Het
Unc13c ATA ATAGTA 9: 73,933,529 probably benign Het
Usp18 T C 6: 121,253,849 I79T possibly damaging Het
Usp9y A T Y: 1,333,656 D1596E possibly damaging Het
Vmn2r109 A T 17: 20,541,274 V607E probably damaging Het
Vwa8 G A 14: 79,038,201 R808K probably null Het
Zfp248 A G 6: 118,429,657 Y324H probably damaging Het
Zfp513 G A 5: 31,199,788 P387S possibly damaging Het
Other mutations in Rabgap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Rabgap1l APN 1 160738969 missense probably benign 0.02
IGL01309:Rabgap1l APN 1 160700798 missense probably benign 0.00
IGL01448:Rabgap1l APN 1 160740745 splice site probably benign
IGL01886:Rabgap1l APN 1 160342042 missense probably damaging 1.00
IGL02010:Rabgap1l APN 1 160472071 missense probably damaging 0.99
IGL02079:Rabgap1l APN 1 160738970 missense probably benign 0.00
IGL02800:Rabgap1l APN 1 160472053 missense possibly damaging 0.73
IGL03343:Rabgap1l APN 1 160443283 missense probably benign
IGL03388:Rabgap1l APN 1 160733523 splice site probably null
IGL03406:Rabgap1l APN 1 160722169 missense probably damaging 1.00
amerigo UTSW 1 160724036 missense probably damaging 1.00
hispaniola UTSW 1 160645307 critical splice donor site probably null
R0047:Rabgap1l UTSW 1 160231789 splice site probably benign
R0047:Rabgap1l UTSW 1 160231789 splice site probably benign
R0048:Rabgap1l UTSW 1 160627369 splice site probably benign
R0099:Rabgap1l UTSW 1 160682116 missense possibly damaging 0.89
R0201:Rabgap1l UTSW 1 160453745 splice site probably benign
R0432:Rabgap1l UTSW 1 160722205 missense probably benign 0.10
R1104:Rabgap1l UTSW 1 160231875 splice site probably benign
R1220:Rabgap1l UTSW 1 160738909 missense probably damaging 1.00
R1485:Rabgap1l UTSW 1 160733680 missense probably benign 0.06
R1569:Rabgap1l UTSW 1 160702390 missense probably benign 0.08
R1907:Rabgap1l UTSW 1 160645310 missense probably benign 0.07
R2128:Rabgap1l UTSW 1 160738957 missense probably benign 0.00
R2129:Rabgap1l UTSW 1 160738957 missense probably benign 0.00
R2177:Rabgap1l UTSW 1 160724062 missense possibly damaging 0.89
R4636:Rabgap1l UTSW 1 160342090 splice site probably null
R4722:Rabgap1l UTSW 1 160342164 missense possibly damaging 0.81
R4743:Rabgap1l UTSW 1 160453783 missense probably damaging 1.00
R4913:Rabgap1l UTSW 1 160238541 missense probably damaging 1.00
R4915:Rabgap1l UTSW 1 160441842 missense probably benign 0.01
R5035:Rabgap1l UTSW 1 160724036 missense probably damaging 1.00
R5087:Rabgap1l UTSW 1 160722239 missense probably damaging 1.00
R5437:Rabgap1l UTSW 1 160722147 missense probably damaging 1.00
R5507:Rabgap1l UTSW 1 160351328 missense possibly damaging 0.83
R5619:Rabgap1l UTSW 1 160238572 missense probably benign 0.00
R5691:Rabgap1l UTSW 1 160735684 missense probably damaging 1.00
R5837:Rabgap1l UTSW 1 160307222 utr 3 prime probably benign
R5881:Rabgap1l UTSW 1 160342113 missense probably damaging 1.00
R6045:Rabgap1l UTSW 1 160645323 missense probably benign 0.00
R6243:Rabgap1l UTSW 1 160645307 critical splice donor site probably null
R6294:Rabgap1l UTSW 1 160231849 missense probably benign 0.14
R6452:Rabgap1l UTSW 1 160453761 missense probably damaging 1.00
R6802:Rabgap1l UTSW 1 160733680 missense probably benign 0.06
R6945:Rabgap1l UTSW 1 160682182 missense probably benign 0.29
R7014:Rabgap1l UTSW 1 160342072 missense probably damaging 1.00
R7062:Rabgap1l UTSW 1 160226650 missense probably benign
R7089:Rabgap1l UTSW 1 160724172 nonsense probably null
R7170:Rabgap1l UTSW 1 160645365 missense probably damaging 1.00
R7172:Rabgap1l UTSW 1 160733586 missense probably benign 0.05
R7303:Rabgap1l UTSW 1 160682097 missense probably benign 0.01
R7466:Rabgap1l UTSW 1 160226484 critical splice donor site probably null
R7501:Rabgap1l UTSW 1 160700788 missense probably damaging 0.98
R7565:Rabgap1l UTSW 1 160251417 missense
R7582:Rabgap1l UTSW 1 160682084 missense probably benign
R7740:Rabgap1l UTSW 1 160682103 missense probably benign 0.01
R7978:Rabgap1l UTSW 1 160251268 missense
R7993:Rabgap1l UTSW 1 160700854 missense probably damaging 1.00
R8116:Rabgap1l UTSW 1 160702442 missense probably benign 0.22
Z1177:Rabgap1l UTSW 1 160739073 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTACAATCTGAGCCCTGGACC -3'
(R):5'- AATGCAGTCAAGCTTTAGTGTGATG -3'

Sequencing Primer
(F):5'- GGACCTTTCACTGAGTCCTACTAAAG -3'
(R):5'- CAGTCAAGCTTTAGTGTGATGTTGTG -3'
Posted On2019-09-13