Incidental Mutation 'R7357:Psd3'
ID571031
Institutional Source Beutler Lab
Gene Symbol Psd3
Ensembl Gene ENSMUSG00000030465
Gene Namepleckstrin and Sec7 domain containing 3
SynonymsEFA6D, 4931420C21Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_030263.5, NM_027626.1; MGI:1918215

Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7357 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location67689082-68212027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68121497 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 11 (K11E)
Ref Sequence ENSEMBL: ENSMUSP00000148783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178529] [ENSMUST00000212960]
Predicted Effect probably damaging
Transcript: ENSMUST00000178529
AA Change: K11E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137221
Gene: ENSMUSG00000095306
AA Change: K11E

DomainStartEndE-ValueType
low complexity region 18 44 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 100 108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178529
AA Change: K11E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000212960
AA Change: K11E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A T 2: 156,003,867 H23Q unknown Het
9530068E07Rik A T 11: 52,406,994 K233I probably damaging Het
Aldh1l2 T C 10: 83,514,544 M320V possibly damaging Het
C2cd3 A G 7: 100,430,103 N838S Het
Cacna1s T C 1: 136,071,021 F218S probably damaging Het
Carmil3 G T 14: 55,491,133 probably benign Het
Cd300a A T 11: 114,893,327 T54S probably benign Het
Celf3 G A 3: 94,480,330 E70K probably damaging Het
Celsr1 A C 15: 86,030,514 M1086R probably benign Het
Ces2f G A 8: 104,949,963 M96I probably benign Het
Chrdl2 G A 7: 100,029,207 V329I probably benign Het
Ctc1 T A 11: 69,034,742 L1035Q probably benign Het
Dbi A G 1: 120,119,893 probably null Het
Dock3 A G 9: 107,005,369 I405T probably benign Het
Dpp4 A T 2: 62,387,077 W59R probably benign Het
Dsg3 T A 18: 20,539,783 I837N probably damaging Het
Fbxw15 A G 9: 109,558,240 V229A probably benign Het
Fermt3 T C 19: 7,002,843 T395A probably benign Het
Focad A T 4: 88,229,335 I404F probably benign Het
Gm4869 A G 5: 140,495,051 R979G possibly damaging Het
Gm8104 T C 14: 43,101,611 I86T probably damaging Het
Gm9857 A C 3: 108,940,162 L95R unknown Het
Hoxa1 A T 6: 52,156,949 S266T probably benign Het
Leng8 T A 7: 4,144,933 Y625* probably null Het
Mast3 A G 8: 70,784,859 V557A probably damaging Het
Morc1 T C 16: 48,622,590 F813L probably benign Het
Ntf3 T A 6: 126,101,998 I182F probably damaging Het
Nup153 G T 13: 46,717,166 A91E probably benign Het
Olfr1402 G C 3: 97,410,655 N175K probably damaging Het
Olfr648 A T 7: 104,179,771 D212E probably damaging Het
Pamr1 G A 2: 102,586,704 W120* probably null Het
Pcsk1 A G 13: 75,125,960 N436S probably damaging Het
Pde4dip T C 3: 97,715,541 K1451E probably benign Het
Pebp4 G A 14: 70,048,415 V176I possibly damaging Het
Phgdh G A 3: 98,339,822 A4V probably benign Het
Pik3c2g T C 6: 139,633,793 probably null Het
Ppic T C 18: 53,411,067 Y82C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ppp1r9b T C 11: 95,004,598 V704A probably benign Het
Pramel6 G T 2: 87,510,512 R396L not run Het
Prss48 A T 3: 85,997,221 D223E probably damaging Het
Rabgap1l T C 1: 160,342,038 K780E probably damaging Het
Retreg1 A T 15: 25,971,943 D323V probably damaging Het
Samd11 A T 4: 156,255,007 probably null Het
Sec14l3 T A 11: 4,070,127 F188Y probably benign Het
Serpina5 A T 12: 104,103,380 T284S possibly damaging Het
Setx A G 2: 29,130,301 D100G probably benign Het
Sis A T 3: 72,925,071 V1035D probably damaging Het
Slco4a1 A G 2: 180,472,137 I456V probably benign Het
Snx14 A T 9: 88,404,316 C393S possibly damaging Het
Stil T C 4: 115,014,226 probably null Het
Sult6b1 A G 17: 78,894,630 S148P probably damaging Het
Sycp2 G T 2: 178,403,804 probably null Het
Tesmin T C 19: 3,397,042 I273T probably benign Het
Tmem39a T A 16: 38,586,230 Y310N probably damaging Het
Trp53bp1 A T 2: 121,211,300 D1258E probably damaging Het
Ttc12 A C 9: 49,438,387 D703E probably benign Het
Unc13c TATAA TATAATAA 9: 73,933,528 probably benign Het
Unc13c ATA ATAGTA 9: 73,933,529 probably benign Het
Usp18 T C 6: 121,253,849 I79T possibly damaging Het
Usp9y A T Y: 1,333,656 D1596E possibly damaging Het
Vmn2r109 A T 17: 20,541,274 V607E probably damaging Het
Vwa8 G A 14: 79,038,201 R808K probably null Het
Zfp248 A G 6: 118,429,657 Y324H probably damaging Het
Zfp513 G A 5: 31,199,788 P387S possibly damaging Het
Other mutations in Psd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Psd3 APN 8 67908679 splice site probably benign
IGL01095:Psd3 APN 8 67908513 missense probably damaging 1.00
IGL01139:Psd3 APN 8 67908535 missense probably damaging 1.00
IGL01330:Psd3 APN 8 67697178 missense probably damaging 1.00
IGL01350:Psd3 APN 8 67720892 missense probably damaging 1.00
IGL01487:Psd3 APN 8 67697114 missense probably benign 0.01
IGL01780:Psd3 APN 8 67963869 missense probably benign
IGL02020:Psd3 APN 8 67974170 intron probably benign
IGL02232:Psd3 APN 8 67904145 missense probably damaging 1.00
IGL02350:Psd3 APN 8 67963869 missense probably benign
IGL02357:Psd3 APN 8 67963869 missense probably benign
PIT4495001:Psd3 UTSW 8 67963913 missense probably benign 0.00
R0052:Psd3 UTSW 8 67882979 critical splice donor site probably null
R0052:Psd3 UTSW 8 67882979 critical splice donor site probably null
R0242:Psd3 UTSW 8 67758086 missense probably damaging 0.99
R0242:Psd3 UTSW 8 67758086 missense probably damaging 0.99
R0581:Psd3 UTSW 8 67720946 missense probably damaging 1.00
R0655:Psd3 UTSW 8 67963689 missense probably benign 0.19
R1740:Psd3 UTSW 8 68120839 missense probably damaging 1.00
R1789:Psd3 UTSW 8 67960565 missense probably benign 0.26
R1847:Psd3 UTSW 8 67720004 missense possibly damaging 0.93
R1951:Psd3 UTSW 8 67963487 missense probably benign 0.00
R1954:Psd3 UTSW 8 67697075 missense probably damaging 1.00
R2143:Psd3 UTSW 8 67964351 missense probably damaging 1.00
R4387:Psd3 UTSW 8 68000761 missense probably damaging 1.00
R4801:Psd3 UTSW 8 68121148 missense probably benign
R4802:Psd3 UTSW 8 68121148 missense probably benign
R4913:Psd3 UTSW 8 68121169 missense probably damaging 0.99
R5045:Psd3 UTSW 8 67713825 missense probably damaging 0.99
R5173:Psd3 UTSW 8 67696989 missense probably damaging 1.00
R5264:Psd3 UTSW 8 67713725 missense probably benign 0.23
R5350:Psd3 UTSW 8 67908861 missense probably benign 0.00
R5816:Psd3 UTSW 8 67960510 missense possibly damaging 0.90
R5994:Psd3 UTSW 8 67719968 missense probably damaging 1.00
R6157:Psd3 UTSW 8 68121527 start codon destroyed probably benign 0.14
R6241:Psd3 UTSW 8 67818139 intron probably benign
R6586:Psd3 UTSW 8 67963545 missense probably damaging 0.96
R6735:Psd3 UTSW 8 68120746 critical splice donor site probably null
R6908:Psd3 UTSW 8 67964177 missense probably benign 0.00
R6984:Psd3 UTSW 8 67818045 missense possibly damaging 0.85
R7082:Psd3 UTSW 8 67904148 missense probably benign 0.03
R7116:Psd3 UTSW 8 67713738 missense probably benign 0.12
R7297:Psd3 UTSW 8 68121034 missense probably damaging 0.98
R7334:Psd3 UTSW 8 67908705 missense possibly damaging 0.94
R7348:Psd3 UTSW 8 67790931 missense possibly damaging 0.65
R7369:Psd3 UTSW 8 67904166 missense possibly damaging 0.95
R7385:Psd3 UTSW 8 68000756 missense probably damaging 1.00
R7733:Psd3 UTSW 8 68120916 missense possibly damaging 0.75
R7873:Psd3 UTSW 8 67882982 missense possibly damaging 0.95
R8110:Psd3 UTSW 8 68121056 missense probably damaging 1.00
Z1088:Psd3 UTSW 8 67906260 splice site silent
Predicted Primers PCR Primer
(F):5'- AGCCCTGCGTACATCTGAAG -3'
(R):5'- TTCTCCAGCAAACACAATTCTCTG -3'

Sequencing Primer
(F):5'- CTGCGTACATCTGAAGTTCCAGG -3'
(R):5'- CCATTGAAGAGTCCCCCTG -3'
Posted On2019-09-13