Mutagenetix > Incidental Mutation

Incidental Mutation 'R7357:Mast3'

571032

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7357 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70784859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 557 (V557A)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: V573A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V573A

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: V557A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

97% (64/66)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430550D23Rik	A	T	2: 156,003,867	H23Q	unknown	Het
9530068E07Rik	A	T	11: 52,406,994	K233I	probably damaging	Het
Aldh1l2	T	C	10: 83,514,544	M320V	possibly damaging	Het
C2cd3	A	G	7: 100,430,103	N838S		Het
Cacna1s	T	C	1: 136,071,021	F218S	probably damaging	Het
Carmil3	G	T	14: 55,491,133		probably benign	Het
Cd300a	A	T	11: 114,893,327	T54S	probably benign	Het
Celf3	G	A	3: 94,480,330	E70K	probably damaging	Het
Celsr1	A	C	15: 86,030,514	M1086R	probably benign	Het
Ces2f	G	A	8: 104,949,963	M96I	probably benign	Het
Chrdl2	G	A	7: 100,029,207	V329I	probably benign	Het
Ctc1	T	A	11: 69,034,742	L1035Q	probably benign	Het
Dbi	A	G	1: 120,119,893		probably null	Het
Dock3	A	G	9: 107,005,369	I405T	probably benign	Het
Dpp4	A	T	2: 62,387,077	W59R	probably benign	Het
Dsg3	T	A	18: 20,539,783	I837N	probably damaging	Het
Fbxw15	A	G	9: 109,558,240	V229A	probably benign	Het
Fermt3	T	C	19: 7,002,843	T395A	probably benign	Het
Focad	A	T	4: 88,229,335	I404F	probably benign	Het
Gm4869	A	G	5: 140,495,051	R979G	possibly damaging	Het
Gm8104	T	C	14: 43,101,611	I86T	probably damaging	Het
Gm9857	A	C	3: 108,940,162	L95R	unknown	Het
Hoxa1	A	T	6: 52,156,949	S266T	probably benign	Het
Leng8	T	A	7: 4,144,933	Y625*	probably null	Het
Morc1	T	C	16: 48,622,590	F813L	probably benign	Het
Ntf3	T	A	6: 126,101,998	I182F	probably damaging	Het
Nup153	G	T	13: 46,717,166	A91E	probably benign	Het
Olfr1402	G	C	3: 97,410,655	N175K	probably damaging	Het
Olfr648	A	T	7: 104,179,771	D212E	probably damaging	Het
Pamr1	G	A	2: 102,586,704	W120*	probably null	Het
Pcsk1	A	G	13: 75,125,960	N436S	probably damaging	Het
Pde4dip	T	C	3: 97,715,541	K1451E	probably benign	Het
Pebp4	G	A	14: 70,048,415	V176I	possibly damaging	Het
Phgdh	G	A	3: 98,339,822	A4V	probably benign	Het
Pik3c2g	T	C	6: 139,633,793		probably null	Het
Ppic	T	C	18: 53,411,067	Y82C	probably damaging	Het
Ppip5k2	A	G	1: 97,759,216	V94A	possibly damaging	Het
Ppp1r9b	T	C	11: 95,004,598	V704A	probably benign	Het
Pramel6	G	T	2: 87,510,512	R396L	not run	Het
Prss48	A	T	3: 85,997,221	D223E	probably damaging	Het
Psd3	T	C	8: 68,121,497	K11E	probably benign	Het
Rabgap1l	T	C	1: 160,342,038	K780E	probably damaging	Het
Retreg1	A	T	15: 25,971,943	D323V	probably damaging	Het
Samd11	A	T	4: 156,255,007		probably null	Het
Sec14l3	T	A	11: 4,070,127	F188Y	probably benign	Het
Serpina5	A	T	12: 104,103,380	T284S	possibly damaging	Het
Setx	A	G	2: 29,130,301	D100G	probably benign	Het
Sis	A	T	3: 72,925,071	V1035D	probably damaging	Het
Slco4a1	A	G	2: 180,472,137	I456V	probably benign	Het
Snx14	A	T	9: 88,404,316	C393S	possibly damaging	Het
Stil	T	C	4: 115,014,226		probably null	Het
Sult6b1	A	G	17: 78,894,630	S148P	probably damaging	Het
Sycp2	G	T	2: 178,403,804		probably null	Het
Tesmin	T	C	19: 3,397,042	I273T	probably benign	Het
Tmem39a	T	A	16: 38,586,230	Y310N	probably damaging	Het
Trp53bp1	A	T	2: 121,211,300	D1258E	probably damaging	Het
Ttc12	A	C	9: 49,438,387	D703E	probably benign	Het
Unc13c	TATAA	TATAATAA	9: 73,933,528		probably benign	Het
Unc13c	ATA	ATAGTA	9: 73,933,529		probably benign	Het
Usp18	T	C	6: 121,253,849	I79T	possibly damaging	Het
Usp9y	A	T	Y: 1,333,656	D1596E	possibly damaging	Het
Vmn2r109	A	T	17: 20,541,274	V607E	probably damaging	Het
Vwa8	G	A	14: 79,038,201	R808K	probably null	Het
Zfp248	A	G	6: 118,429,657	Y324H	probably damaging	Het
Zfp513	G	A	5: 31,199,788	P387S	possibly damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCATCTGAAGTTCCGGGG -3'
(R):5'- AGCCTCATTTCCCATGTGTG -3'

Sequencing Primer
(F):5'- AGTGTCAGAATGCTCTTTCTAGC -3'
(R):5'- AGCCTCATTTCCCATGTGTGTAAATG -3'

Posted On

2019-09-13