Incidental Mutation 'R7357:Serpina5'
ID571046
Institutional Source Beutler Lab
Gene Symbol Serpina5
Ensembl Gene ENSMUSG00000041550
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 5
Synonymsalpha-1 antiproteinase, Pci, PAI-3, antitrypsin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7357 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location104101113-104106137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104103380 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 284 (T284S)
Ref Sequence ENSEMBL: ENSMUSP00000021495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021495]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021495
AA Change: T284S

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021495
Gene: ENSMUSG00000041550
AA Change: T284S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 48 405 1.4e-160 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. This family member is a glycoprotein that can inhibit several serine proteases, including protein C and various plasminogen activators and kallikreins, and it thus plays diverse roles in hemostasis and thrombosis in multiple organs. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal with the exception that males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A T 2: 156,003,867 H23Q unknown Het
9530068E07Rik A T 11: 52,406,994 K233I probably damaging Het
Aldh1l2 T C 10: 83,514,544 M320V possibly damaging Het
C2cd3 A G 7: 100,430,103 N838S Het
Cacna1s T C 1: 136,071,021 F218S probably damaging Het
Carmil3 G T 14: 55,491,133 probably benign Het
Cd300a A T 11: 114,893,327 T54S probably benign Het
Celf3 G A 3: 94,480,330 E70K probably damaging Het
Celsr1 A C 15: 86,030,514 M1086R probably benign Het
Ces2f G A 8: 104,949,963 M96I probably benign Het
Chrdl2 G A 7: 100,029,207 V329I probably benign Het
Ctc1 T A 11: 69,034,742 L1035Q probably benign Het
Dbi A G 1: 120,119,893 probably null Het
Dock3 A G 9: 107,005,369 I405T probably benign Het
Dpp4 A T 2: 62,387,077 W59R probably benign Het
Dsg3 T A 18: 20,539,783 I837N probably damaging Het
Fbxw15 A G 9: 109,558,240 V229A probably benign Het
Fermt3 T C 19: 7,002,843 T395A probably benign Het
Focad A T 4: 88,229,335 I404F probably benign Het
Gm4869 A G 5: 140,495,051 R979G possibly damaging Het
Gm8104 T C 14: 43,101,611 I86T probably damaging Het
Gm9857 A C 3: 108,940,162 L95R unknown Het
Hoxa1 A T 6: 52,156,949 S266T probably benign Het
Leng8 T A 7: 4,144,933 Y625* probably null Het
Mast3 A G 8: 70,784,859 V557A probably damaging Het
Morc1 T C 16: 48,622,590 F813L probably benign Het
Ntf3 T A 6: 126,101,998 I182F probably damaging Het
Nup153 G T 13: 46,717,166 A91E probably benign Het
Olfr1402 G C 3: 97,410,655 N175K probably damaging Het
Olfr648 A T 7: 104,179,771 D212E probably damaging Het
Pamr1 G A 2: 102,586,704 W120* probably null Het
Pcsk1 A G 13: 75,125,960 N436S probably damaging Het
Pde4dip T C 3: 97,715,541 K1451E probably benign Het
Pebp4 G A 14: 70,048,415 V176I possibly damaging Het
Phgdh G A 3: 98,339,822 A4V probably benign Het
Pik3c2g T C 6: 139,633,793 probably null Het
Ppic T C 18: 53,411,067 Y82C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ppp1r9b T C 11: 95,004,598 V704A probably benign Het
Pramel6 G T 2: 87,510,512 R396L not run Het
Prss48 A T 3: 85,997,221 D223E probably damaging Het
Psd3 T C 8: 68,121,497 K11E probably benign Het
Rabgap1l T C 1: 160,342,038 K780E probably damaging Het
Retreg1 A T 15: 25,971,943 D323V probably damaging Het
Samd11 A T 4: 156,255,007 probably null Het
Sec14l3 T A 11: 4,070,127 F188Y probably benign Het
Setx A G 2: 29,130,301 D100G probably benign Het
Sis A T 3: 72,925,071 V1035D probably damaging Het
Slco4a1 A G 2: 180,472,137 I456V probably benign Het
Snx14 A T 9: 88,404,316 C393S possibly damaging Het
Stil T C 4: 115,014,226 probably null Het
Sult6b1 A G 17: 78,894,630 S148P probably damaging Het
Sycp2 G T 2: 178,403,804 probably null Het
Tesmin T C 19: 3,397,042 I273T probably benign Het
Tmem39a T A 16: 38,586,230 Y310N probably damaging Het
Trp53bp1 A T 2: 121,211,300 D1258E probably damaging Het
Ttc12 A C 9: 49,438,387 D703E probably benign Het
Unc13c TATAA TATAATAA 9: 73,933,528 probably benign Het
Unc13c ATA ATAGTA 9: 73,933,529 probably benign Het
Usp18 T C 6: 121,253,849 I79T possibly damaging Het
Usp9y A T Y: 1,333,656 D1596E possibly damaging Het
Vmn2r109 A T 17: 20,541,274 V607E probably damaging Het
Vwa8 G A 14: 79,038,201 R808K probably null Het
Zfp248 A G 6: 118,429,657 Y324H probably damaging Het
Zfp513 G A 5: 31,199,788 P387S possibly damaging Het
Other mutations in Serpina5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Serpina5 APN 12 104105220 missense probably damaging 1.00
IGL01138:Serpina5 APN 12 104103744 missense possibly damaging 0.60
IGL01526:Serpina5 APN 12 104101890 missense probably damaging 1.00
IGL02159:Serpina5 APN 12 104105298 missense possibly damaging 0.95
IGL02351:Serpina5 APN 12 104102125 missense probably damaging 1.00
IGL02358:Serpina5 APN 12 104102125 missense probably damaging 1.00
IGL02735:Serpina5 APN 12 104103857 missense probably benign 0.21
IGL03087:Serpina5 APN 12 104101733 missense probably benign 0.01
R0189:Serpina5 UTSW 12 104103330 missense probably damaging 1.00
R0304:Serpina5 UTSW 12 104103200 missense possibly damaging 0.76
R0492:Serpina5 UTSW 12 104102133 missense probably damaging 1.00
R0511:Serpina5 UTSW 12 104103362 missense probably benign 0.00
R0611:Serpina5 UTSW 12 104103787 missense probably benign
R1016:Serpina5 UTSW 12 104105323 missense probably damaging 0.97
R1649:Serpina5 UTSW 12 104105225 missense possibly damaging 0.94
R1970:Serpina5 UTSW 12 104103857 missense probably benign 0.02
R4429:Serpina5 UTSW 12 104103406 missense probably benign 0.00
R4805:Serpina5 UTSW 12 104102201 missense probably damaging 0.97
R5608:Serpina5 UTSW 12 104103744 missense probably damaging 1.00
R6226:Serpina5 UTSW 12 104101778 missense possibly damaging 0.72
R7097:Serpina5 UTSW 12 104102295 critical splice donor site probably null
R8208:Serpina5 UTSW 12 104105273 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGCCTTCAGTGAGACAAAC -3'
(R):5'- GTCATGTCCTGGACTGAAGAC -3'

Sequencing Primer
(F):5'- GATTTCCATGTGACCCCCAAAAGG -3'
(R):5'- CATGTCCTGGACTGAAGACTTGATG -3'
Posted On2019-09-13