Incidental Mutation 'R7357:Nup153'
ID571047
Institutional Source Beutler Lab
Gene Symbol Nup153
Ensembl Gene ENSMUSG00000021374
Gene Namenucleoporin 153
SynonymsB130015D15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R7357 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location46679905-46727940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46717166 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 91 (A91E)
Ref Sequence ENSEMBL: ENSMUSP00000021803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021803]
Predicted Effect probably benign
Transcript: ENSMUST00000021803
AA Change: A91E

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021803
Gene: ENSMUSG00000021374
AA Change: A91E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Nup153 114 627 6e-236 PFAM
ZnF_RBZ 656 680 6.56e-6 SMART
ZnF_RBZ 719 743 5.89e-8 SMART
low complexity region 756 775 N/A INTRINSIC
ZnF_RBZ 787 811 7.2e-3 SMART
low complexity region 815 830 N/A INTRINSIC
ZnF_RBZ 844 868 1.64e-6 SMART
low complexity region 898 911 N/A INTRINSIC
low complexity region 1078 1085 N/A INTRINSIC
low complexity region 1183 1207 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1271 1296 N/A INTRINSIC
Pfam:Nup_retrotrp_bd 1372 1462 4.4e-24 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes regulate the transport of macromolecules between the nucleus and cytoplasm. They are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. Nucleoporins are glycoproteins found in nuclear pores and contain characteristic pentapeptide XFXFG repeats as well as O-linked N-acetylglucosamine residues oriented towards the cytoplasm. The protein encoded by this gene has three distinct domains: a N-terminal region containing a pore targeting and an RNA-binding domain domain, a central region containing multiple zinc finger motifs, and a C-terminal region containing multiple XFXFG repeats. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A T 2: 156,003,867 H23Q unknown Het
9530068E07Rik A T 11: 52,406,994 K233I probably damaging Het
Aldh1l2 T C 10: 83,514,544 M320V possibly damaging Het
C2cd3 A G 7: 100,430,103 N838S Het
Cacna1s T C 1: 136,071,021 F218S probably damaging Het
Carmil3 G T 14: 55,491,133 probably benign Het
Cd300a A T 11: 114,893,327 T54S probably benign Het
Celf3 G A 3: 94,480,330 E70K probably damaging Het
Celsr1 A C 15: 86,030,514 M1086R probably benign Het
Ces2f G A 8: 104,949,963 M96I probably benign Het
Chrdl2 G A 7: 100,029,207 V329I probably benign Het
Ctc1 T A 11: 69,034,742 L1035Q probably benign Het
Dbi A G 1: 120,119,893 probably null Het
Dock3 A G 9: 107,005,369 I405T probably benign Het
Dpp4 A T 2: 62,387,077 W59R probably benign Het
Dsg3 T A 18: 20,539,783 I837N probably damaging Het
Fbxw15 A G 9: 109,558,240 V229A probably benign Het
Fermt3 T C 19: 7,002,843 T395A probably benign Het
Focad A T 4: 88,229,335 I404F probably benign Het
Gm4869 A G 5: 140,495,051 R979G possibly damaging Het
Gm8104 T C 14: 43,101,611 I86T probably damaging Het
Gm9857 A C 3: 108,940,162 L95R unknown Het
Hoxa1 A T 6: 52,156,949 S266T probably benign Het
Leng8 T A 7: 4,144,933 Y625* probably null Het
Mast3 A G 8: 70,784,859 V557A probably damaging Het
Morc1 T C 16: 48,622,590 F813L probably benign Het
Ntf3 T A 6: 126,101,998 I182F probably damaging Het
Olfr1402 G C 3: 97,410,655 N175K probably damaging Het
Olfr648 A T 7: 104,179,771 D212E probably damaging Het
Pamr1 G A 2: 102,586,704 W120* probably null Het
Pcsk1 A G 13: 75,125,960 N436S probably damaging Het
Pde4dip T C 3: 97,715,541 K1451E probably benign Het
Pebp4 G A 14: 70,048,415 V176I possibly damaging Het
Phgdh G A 3: 98,339,822 A4V probably benign Het
Pik3c2g T C 6: 139,633,793 probably null Het
Ppic T C 18: 53,411,067 Y82C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ppp1r9b T C 11: 95,004,598 V704A probably benign Het
Pramel6 G T 2: 87,510,512 R396L not run Het
Prss48 A T 3: 85,997,221 D223E probably damaging Het
Psd3 T C 8: 68,121,497 K11E probably benign Het
Rabgap1l T C 1: 160,342,038 K780E probably damaging Het
Retreg1 A T 15: 25,971,943 D323V probably damaging Het
Samd11 A T 4: 156,255,007 probably null Het
Sec14l3 T A 11: 4,070,127 F188Y probably benign Het
Serpina5 A T 12: 104,103,380 T284S possibly damaging Het
Setx A G 2: 29,130,301 D100G probably benign Het
Sis A T 3: 72,925,071 V1035D probably damaging Het
Slco4a1 A G 2: 180,472,137 I456V probably benign Het
Snx14 A T 9: 88,404,316 C393S possibly damaging Het
Stil T C 4: 115,014,226 probably null Het
Sult6b1 A G 17: 78,894,630 S148P probably damaging Het
Sycp2 G T 2: 178,403,804 probably null Het
Tesmin T C 19: 3,397,042 I273T probably benign Het
Tmem39a T A 16: 38,586,230 Y310N probably damaging Het
Trp53bp1 A T 2: 121,211,300 D1258E probably damaging Het
Ttc12 A C 9: 49,438,387 D703E probably benign Het
Unc13c TATAA TATAATAA 9: 73,933,528 probably benign Het
Unc13c ATA ATAGTA 9: 73,933,529 probably benign Het
Usp18 T C 6: 121,253,849 I79T possibly damaging Het
Usp9y A T Y: 1,333,656 D1596E possibly damaging Het
Vmn2r109 A T 17: 20,541,274 V607E probably damaging Het
Vwa8 G A 14: 79,038,201 R808K probably null Het
Zfp248 A G 6: 118,429,657 Y324H probably damaging Het
Zfp513 G A 5: 31,199,788 P387S possibly damaging Het
Other mutations in Nup153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nup153 APN 13 46681150 unclassified probably benign
IGL01312:Nup153 APN 13 46686824 missense probably benign 0.03
IGL01459:Nup153 APN 13 46712926 missense possibly damaging 0.84
IGL01646:Nup153 APN 13 46684107 missense possibly damaging 0.80
IGL03064:Nup153 APN 13 46693839 missense probably benign
IGL03288:Nup153 APN 13 46705205 missense possibly damaging 0.71
IGL03369:Nup153 APN 13 46700983 splice site probably null
IGL03371:Nup153 APN 13 46683152 missense probably benign 0.34
R0193:Nup153 UTSW 13 46709654 missense probably benign 0.01
R0244:Nup153 UTSW 13 46693936 missense probably benign 0.03
R0448:Nup153 UTSW 13 46717181 missense probably benign 0.00
R0943:Nup153 UTSW 13 46696772 splice site probably benign
R1219:Nup153 UTSW 13 46687219 missense probably benign 0.01
R1381:Nup153 UTSW 13 46689181 missense probably damaging 1.00
R1709:Nup153 UTSW 13 46693974 missense probably damaging 1.00
R1727:Nup153 UTSW 13 46693785 missense probably damaging 1.00
R1818:Nup153 UTSW 13 46681637 missense possibly damaging 0.94
R1824:Nup153 UTSW 13 46713747 missense probably damaging 1.00
R1928:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R2108:Nup153 UTSW 13 46693510 critical splice donor site probably null
R2110:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2111:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2173:Nup153 UTSW 13 46701600 splice site probably benign
R2231:Nup153 UTSW 13 46709627 critical splice donor site probably null
R3879:Nup153 UTSW 13 46683960 missense probably damaging 1.00
R4634:Nup153 UTSW 13 46687230 missense possibly damaging 0.49
R4662:Nup153 UTSW 13 46687274 missense possibly damaging 0.68
R4932:Nup153 UTSW 13 46712737 nonsense probably null
R5011:Nup153 UTSW 13 46687403 missense possibly damaging 0.62
R5023:Nup153 UTSW 13 46681109 unclassified probably benign
R5069:Nup153 UTSW 13 46709792 missense probably benign 0.05
R5137:Nup153 UTSW 13 46684153 missense probably damaging 0.99
R5323:Nup153 UTSW 13 46717206 missense probably benign 0.19
R5345:Nup153 UTSW 13 46686865 nonsense probably null
R5536:Nup153 UTSW 13 46683009 missense probably benign 0.01
R5613:Nup153 UTSW 13 46687271 missense possibly damaging 0.64
R5620:Nup153 UTSW 13 46684006 nonsense probably null
R5764:Nup153 UTSW 13 46687327 missense probably damaging 0.97
R5849:Nup153 UTSW 13 46686976 missense probably damaging 0.99
R6454:Nup153 UTSW 13 46709660 splice site probably null
R6701:Nup153 UTSW 13 46687065 missense probably benign 0.00
R6721:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R6737:Nup153 UTSW 13 46689206 missense probably benign 0.08
R6789:Nup153 UTSW 13 46717316 missense probably damaging 1.00
R6820:Nup153 UTSW 13 46709983 missense probably benign 0.09
R6837:Nup153 UTSW 13 46694051 missense probably damaging 1.00
R6913:Nup153 UTSW 13 46699716 missense probably damaging 1.00
R7052:Nup153 UTSW 13 46687473 missense probably benign 0.09
R7091:Nup153 UTSW 13 46683928 missense probably benign
R7389:Nup153 UTSW 13 46700987 critical splice donor site probably null
R7423:Nup153 UTSW 13 46696644 critical splice donor site probably null
R7453:Nup153 UTSW 13 46681181 missense probably damaging 1.00
R7611:Nup153 UTSW 13 46687322 missense probably benign 0.01
R7876:Nup153 UTSW 13 46681608 missense probably benign
R7909:Nup153 UTSW 13 46693580 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCATTCCAAATGTTCCATACAGG -3'
(R):5'- GCTTGGCATGACTTTCTGTAAGTAC -3'

Sequencing Primer
(F):5'- GATGCTATCACACTCAGGT -3'
(R):5'- CTTAATGTATGTTTTCTCCAACAGGG -3'
Posted On2019-09-13