Incidental Mutation 'R7357:Retreg1'
ID571052
Institutional Source Beutler Lab
Gene Symbol Retreg1
Ensembl Gene ENSMUSG00000022270
Gene Namereticulophagy regulator 1
Synonyms1810015C04Rik, Fam134b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7357 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location25843180-25973687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25971943 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 323 (D323V)
Ref Sequence ENSEMBL: ENSMUSP00000106068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022881] [ENSMUST00000110438] [ENSMUST00000226438] [ENSMUST00000227275] [ENSMUST00000228306] [ENSMUST00000228327]
Predicted Effect unknown
Transcript: ENSMUST00000022881
AA Change: D447V
SMART Domains Protein: ENSMUSP00000022881
Gene: ENSMUSG00000022270
AA Change: D447V

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110438
AA Change: D323V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106068
Gene: ENSMUSG00000022270
AA Change: D323V

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226438
AA Change: D331V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227275
AA Change: D323V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000228306
AA Change: D313V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000228327
Meta Mutation Damage Score 0.1409 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cis-Golgi transmembrane protein that may be necessary for the long-term survival of nociceptive and autonomic ganglion neurons. Mutations in this gene are a cause of hereditary sensory and autonomic neuropathy type IIB (HSAN IIB), and this gene may also play a role in susceptibility to vascular dementia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased thermal nociceptive threshold and sensory neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A T 2: 156,003,867 H23Q unknown Het
9530068E07Rik A T 11: 52,406,994 K233I probably damaging Het
Aldh1l2 T C 10: 83,514,544 M320V possibly damaging Het
C2cd3 A G 7: 100,430,103 N838S Het
Cacna1s T C 1: 136,071,021 F218S probably damaging Het
Carmil3 G T 14: 55,491,133 probably benign Het
Cd300a A T 11: 114,893,327 T54S probably benign Het
Celf3 G A 3: 94,480,330 E70K probably damaging Het
Celsr1 A C 15: 86,030,514 M1086R probably benign Het
Ces2f G A 8: 104,949,963 M96I probably benign Het
Chrdl2 G A 7: 100,029,207 V329I probably benign Het
Ctc1 T A 11: 69,034,742 L1035Q probably benign Het
Dbi A G 1: 120,119,893 probably null Het
Dock3 A G 9: 107,005,369 I405T probably benign Het
Dpp4 A T 2: 62,387,077 W59R probably benign Het
Dsg3 T A 18: 20,539,783 I837N probably damaging Het
Fbxw15 A G 9: 109,558,240 V229A probably benign Het
Fermt3 T C 19: 7,002,843 T395A probably benign Het
Focad A T 4: 88,229,335 I404F probably benign Het
Gm4869 A G 5: 140,495,051 R979G possibly damaging Het
Gm8104 T C 14: 43,101,611 I86T probably damaging Het
Gm9857 A C 3: 108,940,162 L95R unknown Het
Hoxa1 A T 6: 52,156,949 S266T probably benign Het
Leng8 T A 7: 4,144,933 Y625* probably null Het
Mast3 A G 8: 70,784,859 V557A probably damaging Het
Morc1 T C 16: 48,622,590 F813L probably benign Het
Ntf3 T A 6: 126,101,998 I182F probably damaging Het
Nup153 G T 13: 46,717,166 A91E probably benign Het
Olfr1402 G C 3: 97,410,655 N175K probably damaging Het
Olfr648 A T 7: 104,179,771 D212E probably damaging Het
Pamr1 G A 2: 102,586,704 W120* probably null Het
Pcsk1 A G 13: 75,125,960 N436S probably damaging Het
Pde4dip T C 3: 97,715,541 K1451E probably benign Het
Pebp4 G A 14: 70,048,415 V176I possibly damaging Het
Phgdh G A 3: 98,339,822 A4V probably benign Het
Pik3c2g T C 6: 139,633,793 probably null Het
Ppic T C 18: 53,411,067 Y82C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ppp1r9b T C 11: 95,004,598 V704A probably benign Het
Pramel6 G T 2: 87,510,512 R396L not run Het
Prss48 A T 3: 85,997,221 D223E probably damaging Het
Psd3 T C 8: 68,121,497 K11E probably benign Het
Rabgap1l T C 1: 160,342,038 K780E probably damaging Het
Samd11 A T 4: 156,255,007 probably null Het
Sec14l3 T A 11: 4,070,127 F188Y probably benign Het
Serpina5 A T 12: 104,103,380 T284S possibly damaging Het
Setx A G 2: 29,130,301 D100G probably benign Het
Sis A T 3: 72,925,071 V1035D probably damaging Het
Slco4a1 A G 2: 180,472,137 I456V probably benign Het
Snx14 A T 9: 88,404,316 C393S possibly damaging Het
Stil T C 4: 115,014,226 probably null Het
Sult6b1 A G 17: 78,894,630 S148P probably damaging Het
Sycp2 G T 2: 178,403,804 probably null Het
Tesmin T C 19: 3,397,042 I273T probably benign Het
Tmem39a T A 16: 38,586,230 Y310N probably damaging Het
Trp53bp1 A T 2: 121,211,300 D1258E probably damaging Het
Ttc12 A C 9: 49,438,387 D703E probably benign Het
Unc13c TATAA TATAATAA 9: 73,933,528 probably benign Het
Unc13c ATA ATAGTA 9: 73,933,529 probably benign Het
Usp18 T C 6: 121,253,849 I79T possibly damaging Het
Usp9y A T Y: 1,333,656 D1596E possibly damaging Het
Vmn2r109 A T 17: 20,541,274 V607E probably damaging Het
Vwa8 G A 14: 79,038,201 R808K probably null Het
Zfp248 A G 6: 118,429,657 Y324H probably damaging Het
Zfp513 G A 5: 31,199,788 P387S possibly damaging Het
Other mutations in Retreg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Retreg1 APN 15 25966623 splice site probably null
IGL02548:Retreg1 APN 15 25895118 nonsense probably null
R0834:Retreg1 UTSW 15 25971670 missense probably benign 0.01
R1923:Retreg1 UTSW 15 25969838 missense probably damaging 1.00
R1965:Retreg1 UTSW 15 25970164 missense probably damaging 1.00
R4444:Retreg1 UTSW 15 25968444 splice site probably null
R4529:Retreg1 UTSW 15 25968514 missense probably damaging 1.00
R4778:Retreg1 UTSW 15 25971785 missense possibly damaging 0.60
R5026:Retreg1 UTSW 15 25970128 missense probably damaging 1.00
R5103:Retreg1 UTSW 15 25968454 nonsense probably null
R6880:Retreg1 UTSW 15 25971739 missense probably damaging 1.00
R7275:Retreg1 UTSW 15 25971598 missense probably benign 0.44
R7488:Retreg1 UTSW 15 25889542 missense
R7542:Retreg1 UTSW 15 25941210 start codon destroyed probably null 0.10
R7599:Retreg1 UTSW 15 25971641 missense probably benign 0.04
R7670:Retreg1 UTSW 15 25941040 intron probably benign
R8022:Retreg1 UTSW 15 25843479 missense
R8084:Retreg1 UTSW 15 25969799 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTGATGAGCAACCTGGCTGG -3'
(R):5'- GCACTTAGGACACCACAGTATG -3'

Sequencing Primer
(F):5'- AACCTGGCTGGGGATGTCATC -3'
(R):5'- TCCAACTCACTATAGAAGGGAAAAG -3'
Posted On2019-09-13