Incidental Mutation 'R7357:Morc1'
ID571055
Institutional Source Beutler Lab
Gene Symbol Morc1
Ensembl Gene ENSMUSG00000022652
Gene Namemicrorchidia 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R7357 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location48431237-48630900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48622590 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 813 (F813L)
Ref Sequence ENSEMBL: ENSMUSP00000023330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023330]
Predicted Effect probably benign
Transcript: ENSMUST00000023330
AA Change: F813L

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023330
Gene: ENSMUSG00000022652
AA Change: F813L

DomainStartEndE-ValueType
Pfam:HATPase_c_3 24 161 3.8e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 281 311 N/A INTRINSIC
Pfam:zf-CW 481 528 2e-14 PFAM
low complexity region 639 651 N/A INTRINSIC
coiled coil region 885 916 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of mouse morc and like the mouse protein it is testis-specific. Mouse studies support a testis-specific function since only male knockout mice are infertile; infertility is the only apparent defect. These studies further support a role for this protein early in spermatogenesis, possibly by affecting entry into apoptosis because testis from knockout mice show greatly increased numbers of apoptotic cells. [provided by RefSeq, Jan 2009]
PHENOTYPE: Inactivation of this locus results in small testes and male sterility, the latter owing to meiotic arrest. Mutant females exhibited histologically normal ovaries and were fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A T 2: 156,003,867 H23Q unknown Het
9530068E07Rik A T 11: 52,406,994 K233I probably damaging Het
Aldh1l2 T C 10: 83,514,544 M320V possibly damaging Het
C2cd3 A G 7: 100,430,103 N838S Het
Cacna1s T C 1: 136,071,021 F218S probably damaging Het
Carmil3 G T 14: 55,491,133 probably benign Het
Cd300a A T 11: 114,893,327 T54S probably benign Het
Celf3 G A 3: 94,480,330 E70K probably damaging Het
Celsr1 A C 15: 86,030,514 M1086R probably benign Het
Ces2f G A 8: 104,949,963 M96I probably benign Het
Chrdl2 G A 7: 100,029,207 V329I probably benign Het
Ctc1 T A 11: 69,034,742 L1035Q probably benign Het
Dbi A G 1: 120,119,893 probably null Het
Dock3 A G 9: 107,005,369 I405T probably benign Het
Dpp4 A T 2: 62,387,077 W59R probably benign Het
Dsg3 T A 18: 20,539,783 I837N probably damaging Het
Fbxw15 A G 9: 109,558,240 V229A probably benign Het
Fermt3 T C 19: 7,002,843 T395A probably benign Het
Focad A T 4: 88,229,335 I404F probably benign Het
Gm4869 A G 5: 140,495,051 R979G possibly damaging Het
Gm8104 T C 14: 43,101,611 I86T probably damaging Het
Gm9857 A C 3: 108,940,162 L95R unknown Het
Hoxa1 A T 6: 52,156,949 S266T probably benign Het
Leng8 T A 7: 4,144,933 Y625* probably null Het
Mast3 A G 8: 70,784,859 V557A probably damaging Het
Ntf3 T A 6: 126,101,998 I182F probably damaging Het
Nup153 G T 13: 46,717,166 A91E probably benign Het
Olfr1402 G C 3: 97,410,655 N175K probably damaging Het
Olfr648 A T 7: 104,179,771 D212E probably damaging Het
Pamr1 G A 2: 102,586,704 W120* probably null Het
Pcsk1 A G 13: 75,125,960 N436S probably damaging Het
Pde4dip T C 3: 97,715,541 K1451E probably benign Het
Pebp4 G A 14: 70,048,415 V176I possibly damaging Het
Phgdh G A 3: 98,339,822 A4V probably benign Het
Pik3c2g T C 6: 139,633,793 probably null Het
Ppic T C 18: 53,411,067 Y82C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ppp1r9b T C 11: 95,004,598 V704A probably benign Het
Pramel6 G T 2: 87,510,512 R396L not run Het
Prss48 A T 3: 85,997,221 D223E probably damaging Het
Psd3 T C 8: 68,121,497 K11E probably benign Het
Rabgap1l T C 1: 160,342,038 K780E probably damaging Het
Retreg1 A T 15: 25,971,943 D323V probably damaging Het
Samd11 A T 4: 156,255,007 probably null Het
Sec14l3 T A 11: 4,070,127 F188Y probably benign Het
Serpina5 A T 12: 104,103,380 T284S possibly damaging Het
Setx A G 2: 29,130,301 D100G probably benign Het
Sis A T 3: 72,925,071 V1035D probably damaging Het
Slco4a1 A G 2: 180,472,137 I456V probably benign Het
Snx14 A T 9: 88,404,316 C393S possibly damaging Het
Stil T C 4: 115,014,226 probably null Het
Sult6b1 A G 17: 78,894,630 S148P probably damaging Het
Sycp2 G T 2: 178,403,804 probably null Het
Tesmin T C 19: 3,397,042 I273T probably benign Het
Tmem39a T A 16: 38,586,230 Y310N probably damaging Het
Trp53bp1 A T 2: 121,211,300 D1258E probably damaging Het
Ttc12 A C 9: 49,438,387 D703E probably benign Het
Unc13c TATAA TATAATAA 9: 73,933,528 probably benign Het
Unc13c ATA ATAGTA 9: 73,933,529 probably benign Het
Usp18 T C 6: 121,253,849 I79T possibly damaging Het
Usp9y A T Y: 1,333,656 D1596E possibly damaging Het
Vmn2r109 A T 17: 20,541,274 V607E probably damaging Het
Vwa8 G A 14: 79,038,201 R808K probably null Het
Zfp248 A G 6: 118,429,657 Y324H probably damaging Het
Zfp513 G A 5: 31,199,788 P387S possibly damaging Het
Other mutations in Morc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Morc1 APN 16 48612326 missense probably damaging 0.98
IGL00815:Morc1 APN 16 48460692 missense possibly damaging 0.62
IGL00939:Morc1 APN 16 48452589 missense probably damaging 0.99
IGL01321:Morc1 APN 16 48582462 missense probably benign 0.00
IGL01410:Morc1 APN 16 48612314 missense probably benign 0.16
IGL01557:Morc1 APN 16 48498766 missense probably damaging 1.00
IGL02118:Morc1 APN 16 48587104 missense probably benign 0.01
IGL02626:Morc1 APN 16 48615760 missense probably damaging 0.96
IGL02692:Morc1 APN 16 48510233 missense probably null 0.95
IGL02812:Morc1 APN 16 48558506 splice site probably benign
IGL03232:Morc1 APN 16 48630802 missense probably benign 0.06
IGL03331:Morc1 APN 16 48612368 splice site probably benign
IGL03408:Morc1 APN 16 48442412 missense probably damaging 1.00
R0545:Morc1 UTSW 16 48565657 missense probably benign 0.05
R0569:Morc1 UTSW 16 48587122 missense probably benign 0.02
R0699:Morc1 UTSW 16 48592614 missense probably benign 0.01
R1717:Morc1 UTSW 16 48452477 missense probably benign 0.01
R1728:Morc1 UTSW 16 48612297 missense probably benign 0.10
R1803:Morc1 UTSW 16 48622638 missense probably benign 0.14
R1864:Morc1 UTSW 16 48592530 missense probably benign 0.01
R2008:Morc1 UTSW 16 48565646 missense probably benign 0.41
R2070:Morc1 UTSW 16 48592611 missense probably benign 0.00
R2071:Morc1 UTSW 16 48592611 missense probably benign 0.00
R4851:Morc1 UTSW 16 48561617 missense probably benign 0.02
R5013:Morc1 UTSW 16 48502336 missense probably benign 0.11
R5081:Morc1 UTSW 16 48502352 missense probably benign 0.01
R5259:Morc1 UTSW 16 48630769 missense probably benign 0.12
R5342:Morc1 UTSW 16 48618509 missense probably damaging 0.99
R5481:Morc1 UTSW 16 48561485 splice site probably null
R5561:Morc1 UTSW 16 48449348 missense probably benign 0.43
R6356:Morc1 UTSW 16 48437289 missense probably damaging 1.00
R6526:Morc1 UTSW 16 48587124 nonsense probably null
R6743:Morc1 UTSW 16 48502320 missense probably damaging 0.98
R6940:Morc1 UTSW 16 48479845 nonsense probably null
R6994:Morc1 UTSW 16 48565621 missense probably benign 0.00
R6994:Morc1 UTSW 16 48618546 missense probably benign 0.39
R7009:Morc1 UTSW 16 48627070 missense possibly damaging 0.69
R7346:Morc1 UTSW 16 48630900 splice site probably null
R7448:Morc1 UTSW 16 48431345 missense probably damaging 0.97
R7840:Morc1 UTSW 16 48498784 missense probably benign 0.03
R8417:Morc1 UTSW 16 48460740 missense probably damaging 0.99
X0013:Morc1 UTSW 16 48587068 missense probably benign 0.04
X0027:Morc1 UTSW 16 48498811 missense probably damaging 1.00
Z1176:Morc1 UTSW 16 48587058 missense probably benign 0.03
Z1177:Morc1 UTSW 16 48565706 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTCTCTGTTTCCTGAAGATGTTAATG -3'
(R):5'- TGAGAAACTCTATTTGGTAGGAGAG -3'

Sequencing Primer
(F):5'- CTAGCATCTATCTCTGCCA -3'
(R):5'- AGTCATGGCTAACTGTCTCAG -3'
Posted On2019-09-13