Incidental Mutation 'R7357:Tesmin'
ID571060
Institutional Source Beutler Lab
Gene Symbol Tesmin
Ensembl Gene ENSMUSG00000024905
Gene Nametestis expressed metallothionein like
SynonymsMtl5, tesmin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7357 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location3388857-3407823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3397042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 273 (I273T)
Ref Sequence ENSEMBL: ENSMUSP00000025840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025840] [ENSMUST00000127142] [ENSMUST00000142193] [ENSMUST00000151341]
Predicted Effect probably benign
Transcript: ENSMUST00000025840
AA Change: I273T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025840
Gene: ENSMUSG00000024905
AA Change: I273T

DomainStartEndE-ValueType
low complexity region 91 99 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Blast:CXC 246 287 4e-13 BLAST
CXC 332 373 1.37e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127142
AA Change: I93T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122687
Gene: ENSMUSG00000024905
AA Change: I93T

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142193
AA Change: I93T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114171
Gene: ENSMUSG00000024905
AA Change: I93T

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151341
AA Change: I273T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114142
Gene: ENSMUSG00000024905
AA Change: I273T

DomainStartEndE-ValueType
low complexity region 91 99 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metallothionein proteins are highly conserved low-molecular-weight cysteine-rich proteins that are induced by and bind to heavy metal ions and have no enzymatic activity. They may play a central role in the regulation of cell growth and differentiation and are involved in spermatogenesis. This gene encodes a metallothionein-like protein which has been shown to be expressed differentially in mouse testis and ovary. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A T 2: 156,003,867 H23Q unknown Het
9530068E07Rik A T 11: 52,406,994 K233I probably damaging Het
Aldh1l2 T C 10: 83,514,544 M320V possibly damaging Het
C2cd3 A G 7: 100,430,103 N838S Het
Cacna1s T C 1: 136,071,021 F218S probably damaging Het
Carmil3 G T 14: 55,491,133 probably benign Het
Cd300a A T 11: 114,893,327 T54S probably benign Het
Celf3 G A 3: 94,480,330 E70K probably damaging Het
Celsr1 A C 15: 86,030,514 M1086R probably benign Het
Ces2f G A 8: 104,949,963 M96I probably benign Het
Chrdl2 G A 7: 100,029,207 V329I probably benign Het
Ctc1 T A 11: 69,034,742 L1035Q probably benign Het
Dbi A G 1: 120,119,893 probably null Het
Dock3 A G 9: 107,005,369 I405T probably benign Het
Dpp4 A T 2: 62,387,077 W59R probably benign Het
Dsg3 T A 18: 20,539,783 I837N probably damaging Het
Fbxw15 A G 9: 109,558,240 V229A probably benign Het
Fermt3 T C 19: 7,002,843 T395A probably benign Het
Focad A T 4: 88,229,335 I404F probably benign Het
Gm4869 A G 5: 140,495,051 R979G possibly damaging Het
Gm8104 T C 14: 43,101,611 I86T probably damaging Het
Gm9857 A C 3: 108,940,162 L95R unknown Het
Hoxa1 A T 6: 52,156,949 S266T probably benign Het
Leng8 T A 7: 4,144,933 Y625* probably null Het
Mast3 A G 8: 70,784,859 V557A probably damaging Het
Morc1 T C 16: 48,622,590 F813L probably benign Het
Ntf3 T A 6: 126,101,998 I182F probably damaging Het
Nup153 G T 13: 46,717,166 A91E probably benign Het
Olfr1402 G C 3: 97,410,655 N175K probably damaging Het
Olfr648 A T 7: 104,179,771 D212E probably damaging Het
Pamr1 G A 2: 102,586,704 W120* probably null Het
Pcsk1 A G 13: 75,125,960 N436S probably damaging Het
Pde4dip T C 3: 97,715,541 K1451E probably benign Het
Pebp4 G A 14: 70,048,415 V176I possibly damaging Het
Phgdh G A 3: 98,339,822 A4V probably benign Het
Pik3c2g T C 6: 139,633,793 probably null Het
Ppic T C 18: 53,411,067 Y82C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ppp1r9b T C 11: 95,004,598 V704A probably benign Het
Pramel6 G T 2: 87,510,512 R396L not run Het
Prss48 A T 3: 85,997,221 D223E probably damaging Het
Psd3 T C 8: 68,121,497 K11E probably benign Het
Rabgap1l T C 1: 160,342,038 K780E probably damaging Het
Retreg1 A T 15: 25,971,943 D323V probably damaging Het
Samd11 A T 4: 156,255,007 probably null Het
Sec14l3 T A 11: 4,070,127 F188Y probably benign Het
Serpina5 A T 12: 104,103,380 T284S possibly damaging Het
Setx A G 2: 29,130,301 D100G probably benign Het
Sis A T 3: 72,925,071 V1035D probably damaging Het
Slco4a1 A G 2: 180,472,137 I456V probably benign Het
Snx14 A T 9: 88,404,316 C393S possibly damaging Het
Stil T C 4: 115,014,226 probably null Het
Sult6b1 A G 17: 78,894,630 S148P probably damaging Het
Sycp2 G T 2: 178,403,804 probably null Het
Tmem39a T A 16: 38,586,230 Y310N probably damaging Het
Trp53bp1 A T 2: 121,211,300 D1258E probably damaging Het
Ttc12 A C 9: 49,438,387 D703E probably benign Het
Unc13c TATAA TATAATAA 9: 73,933,528 probably benign Het
Unc13c ATA ATAGTA 9: 73,933,529 probably benign Het
Usp18 T C 6: 121,253,849 I79T possibly damaging Het
Usp9y A T Y: 1,333,656 D1596E possibly damaging Het
Vmn2r109 A T 17: 20,541,274 V607E probably damaging Het
Vwa8 G A 14: 79,038,201 R808K probably null Het
Zfp248 A G 6: 118,429,657 Y324H probably damaging Het
Zfp513 G A 5: 31,199,788 P387S possibly damaging Het
Other mutations in Tesmin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02552:Tesmin APN 19 3402483 unclassified probably benign
R0207:Tesmin UTSW 19 3404088 missense probably benign 0.00
R2441:Tesmin UTSW 19 3402577 critical splice donor site probably null
R5139:Tesmin UTSW 19 3406934 missense probably damaging 1.00
R5272:Tesmin UTSW 19 3406992 missense probably damaging 1.00
R6077:Tesmin UTSW 19 3389260 missense possibly damaging 0.49
R7246:Tesmin UTSW 19 3406965 missense probably damaging 1.00
R7567:Tesmin UTSW 19 3392218 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGCCATGTGATTGTGACACC -3'
(R):5'- GCTACAACTGTGGATCATGGAAC -3'

Sequencing Primer
(F):5'- CCATGTGATTGTGACACCAACATG -3'
(R):5'- TGGAACACACATGGGGTAGC -3'
Posted On2019-09-13