Incidental Mutation 'R7358:Spag16'
ID571066
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R7358 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69844367 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 85 (H85R)
Ref Sequence ENSEMBL: ENSMUSP00000069821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425] [ENSMUST00000113940]
Predicted Effect probably benign
Transcript: ENSMUST00000065425
AA Change: H85R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: H85R

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113940
AA Change: H85R

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109573
Gene: ENSMUSG00000053153
AA Change: H85R

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
low complexity region 342 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,292,013 L1721S possibly damaging Het
Abca17 T A 17: 24,291,555 Q983L probably benign Het
Agtr1a A T 13: 30,380,979 D9V probably benign Het
Ankrd13c T A 3: 157,991,737 Y326* probably null Het
Ano2 A G 6: 125,710,733 D67G probably benign Het
Arhgef5 G A 6: 43,279,573 R1205H probably damaging Het
Ascc3 T A 10: 50,714,352 Y1055* probably null Het
Atad5 C T 11: 80,133,036 A1658V probably benign Het
Atp6ap1l T C 13: 90,883,807 D252G probably damaging Het
BC067074 A G 13: 113,319,967 D849G Het
Bdkrb2 T C 12: 105,592,541 V347A possibly damaging Het
Ccdc187 A T 2: 26,255,995 L1194Q probably damaging Het
Chd9 A C 8: 90,983,487 D770A unknown Het
Chd9 A G 8: 91,034,218 D2197G unknown Het
Clip2 C A 5: 134,502,630 E774* probably null Het
Clspn A G 4: 126,566,200 T407A probably benign Het
Col24a1 T A 3: 145,293,165 probably null Het
Cradd T A 10: 95,322,775 T37S probably damaging Het
Ctbp2 A G 7: 132,998,881 F70S probably damaging Het
D3Ertd751e A T 3: 41,746,565 E6D probably damaging Het
Dst T A 1: 34,191,673 F2782L probably benign Het
Dync2h1 A G 9: 7,159,479 probably null Het
Eif2s1 G T 12: 78,881,195 G215V probably damaging Het
Epg5 A T 18: 77,959,037 D557V possibly damaging Het
Eya4 C T 10: 23,123,851 probably null Het
Fam192a T C 8: 94,575,699 N235D possibly damaging Het
Fpr1 C A 17: 17,876,980 R249L probably damaging Het
Fry A G 5: 150,416,323 T1520A probably benign Het
Gapvd1 C T 2: 34,690,461 probably null Het
Gemin4 A C 11: 76,213,452 L161* probably null Het
Gid8 A T 2: 180,717,986 K221I probably benign Het
Gm21028 A C 7: 42,578,489 C34G probably damaging Het
Gm4737 T C 16: 46,153,838 E392G probably damaging Het
Greb1 A G 12: 16,724,881 S172P probably damaging Het
Herc2 A G 7: 56,182,675 I3040V possibly damaging Het
Hmcn2 T A 2: 31,416,812 V3190E probably damaging Het
Hrnr G T 3: 93,323,141 G229* probably null Het
Igfn1 A T 1: 135,964,000 V2259D probably damaging Het
Ism2 A G 12: 87,280,040 F375S probably damaging Het
Kcnk4 T A 19: 6,926,110 D357V probably damaging Het
Knl1 A G 2: 119,070,559 R914G possibly damaging Het
Mars2 T C 1: 55,237,570 S111P probably damaging Het
Mogat2 G A 7: 99,232,466 P88S possibly damaging Het
Msh2 T A 17: 87,717,529 S612T possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1029 T A 2: 85,975,436 S64R possibly damaging Het
Olfr352 T C 2: 36,869,878 V104A probably benign Het
Olfr621-ps1 A G 7: 103,629,183 L259P unknown Het
Olfr709-ps1 A T 7: 106,926,904 L185Q probably damaging Het
Olfr771 T A 10: 129,160,070 I305F probably benign Het
Olfr868 A T 9: 20,100,873 Y38F probably damaging Het
P2rx7 A T 5: 122,666,142 probably null Het
Pard3 A T 8: 127,593,092 I1149L probably damaging Het
Pcdha8 T A 18: 36,992,777 I104N probably damaging Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pgap2 A T 7: 102,210,567 probably benign Het
Phf7 T C 14: 31,241,788 R76G probably benign Het
Pigu T C 2: 155,299,170 T268A probably damaging Het
Piwil4 T C 9: 14,729,993 T231A possibly damaging Het
Pkd1l1 T G 11: 8,945,202 E636A Het
Plscr3 T C 11: 69,847,490 S55P unknown Het
Pnlip T A 19: 58,676,544 I268N probably damaging Het
Podxl A T 6: 31,524,994 H343Q probably benign Het
Prkcd T C 14: 30,605,836 T213A probably benign Het
Prss22 T A 17: 23,996,445 Q119L probably benign Het
Ptprcap A G 19: 4,156,239 E107G possibly damaging Het
Ptprg A G 14: 12,154,198 T640A possibly damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Rasa4 A G 5: 136,095,594 T166A probably benign Het
Sbf2 T C 7: 110,399,348 E626G possibly damaging Het
Scn2a T A 2: 65,682,506 Y203* probably null Het
Serpinb1a G C 13: 32,842,998 H320Q probably damaging Het
Shisa7 G A 7: 4,829,921 T464I probably benign Het
Slc47a2 G A 11: 61,308,873 A399V possibly damaging Het
Smim4 A G 14: 31,124,603 V53A probably damaging Het
Snrnp200 A G 2: 127,221,826 T642A probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stag3 C A 5: 138,301,508 L894M probably damaging Het
Sun2 A T 15: 79,734,112 F284Y probably benign Het
Tpx2 T A 2: 152,876,630 N184K probably benign Het
Trpa1 A T 1: 14,898,110 N477K probably damaging Het
Ttbk2 C T 2: 120,790,310 R157H probably damaging Het
Ttn C T 2: 76,707,305 E34760K probably benign Het
Tysnd1 T C 10: 61,696,648 S360P probably damaging Het
Usp34 T A 11: 23,361,683 L511I probably damaging Het
Vmn2r71 A T 7: 85,624,260 T761S possibly damaging Het
Zdhhc18 G T 4: 133,633,171 C73* probably null Het
Zfp975 A T 7: 42,662,791 C133S probably damaging Het
Zfy1 T C Y: 735,141 E214G unknown Het
Zmym5 T A 14: 56,794,140 K504* probably null Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 utr 3 prime probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7431:Spag16 UTSW 1 69923872 missense unknown
R7508:Spag16 UTSW 1 69887520 missense possibly damaging 0.93
R7566:Spag16 UTSW 1 69870328 missense probably damaging 1.00
R7570:Spag16 UTSW 1 69996841 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTACCGTTGGATGTTTGAGAATG -3'
(R):5'- GGAAGGTATTAGTTGTTGGAAACTC -3'

Sequencing Primer
(F):5'- ATGTATTCCTCATATAGGTTGGGGAC -3'
(R):5'- AGTTGTTGGAAACTCATGTAAGAG -3'
Posted On2019-09-13