Incidental Mutation 'R7358:Pecr'
ID571067
Institutional Source Beutler Lab
Gene Symbol Pecr
Ensembl Gene ENSMUSG00000026189
Gene Nameperoxisomal trans-2-enoyl-CoA reductase
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R7358 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location72259167-72284314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72267465 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 219 (T219I)
Ref Sequence ENSEMBL: ENSMUSP00000027381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027381] [ENSMUST00000097698] [ENSMUST00000129458] [ENSMUST00000134840]
Predicted Effect probably benign
Transcript: ENSMUST00000027381
AA Change: T219I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027381
Gene: ENSMUSG00000026189
AA Change: T219I

DomainStartEndE-ValueType
Pfam:adh_short 19 216 5e-47 PFAM
Pfam:KR 20 148 2.3e-10 PFAM
Pfam:adh_short_C2 25 266 4.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097698
AA Change: T219I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000095304
Gene: ENSMUSG00000026189
AA Change: T219I

DomainStartEndE-ValueType
Pfam:adh_short 19 190 5.8e-26 PFAM
Pfam:KR 20 148 9.3e-12 PFAM
Pfam:adh_short_C2 25 242 8.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129458
Predicted Effect probably benign
Transcript: ENSMUST00000134840
SMART Domains Protein: ENSMUSP00000120890
Gene: ENSMUSG00000026189

DomainStartEndE-ValueType
Pfam:adh_short 19 89 1.7e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,292,013 L1721S possibly damaging Het
Abca17 T A 17: 24,291,555 Q983L probably benign Het
Agtr1a A T 13: 30,380,979 D9V probably benign Het
Ankrd13c T A 3: 157,991,737 Y326* probably null Het
Ano2 A G 6: 125,710,733 D67G probably benign Het
Arhgef5 G A 6: 43,279,573 R1205H probably damaging Het
Ascc3 T A 10: 50,714,352 Y1055* probably null Het
Atad5 C T 11: 80,133,036 A1658V probably benign Het
Atp6ap1l T C 13: 90,883,807 D252G probably damaging Het
BC067074 A G 13: 113,319,967 D849G Het
Bdkrb2 T C 12: 105,592,541 V347A possibly damaging Het
Ccdc187 A T 2: 26,255,995 L1194Q probably damaging Het
Chd9 A C 8: 90,983,487 D770A unknown Het
Chd9 A G 8: 91,034,218 D2197G unknown Het
Clip2 C A 5: 134,502,630 E774* probably null Het
Clspn A G 4: 126,566,200 T407A probably benign Het
Col24a1 T A 3: 145,293,165 probably null Het
Cradd T A 10: 95,322,775 T37S probably damaging Het
Ctbp2 A G 7: 132,998,881 F70S probably damaging Het
D3Ertd751e A T 3: 41,746,565 E6D probably damaging Het
Dst T A 1: 34,191,673 F2782L probably benign Het
Dync2h1 A G 9: 7,159,479 probably null Het
Eif2s1 G T 12: 78,881,195 G215V probably damaging Het
Epg5 A T 18: 77,959,037 D557V possibly damaging Het
Eya4 C T 10: 23,123,851 probably null Het
Fam192a T C 8: 94,575,699 N235D possibly damaging Het
Fpr1 C A 17: 17,876,980 R249L probably damaging Het
Fry A G 5: 150,416,323 T1520A probably benign Het
Gapvd1 C T 2: 34,690,461 probably null Het
Gemin4 A C 11: 76,213,452 L161* probably null Het
Gid8 A T 2: 180,717,986 K221I probably benign Het
Gm21028 A C 7: 42,578,489 C34G probably damaging Het
Gm4737 T C 16: 46,153,838 E392G probably damaging Het
Greb1 A G 12: 16,724,881 S172P probably damaging Het
Herc2 A G 7: 56,182,675 I3040V possibly damaging Het
Hmcn2 T A 2: 31,416,812 V3190E probably damaging Het
Hrnr G T 3: 93,323,141 G229* probably null Het
Igfn1 A T 1: 135,964,000 V2259D probably damaging Het
Ism2 A G 12: 87,280,040 F375S probably damaging Het
Kcnk4 T A 19: 6,926,110 D357V probably damaging Het
Knl1 A G 2: 119,070,559 R914G possibly damaging Het
Mars2 T C 1: 55,237,570 S111P probably damaging Het
Mogat2 G A 7: 99,232,466 P88S possibly damaging Het
Msh2 T A 17: 87,717,529 S612T possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1029 T A 2: 85,975,436 S64R possibly damaging Het
Olfr352 T C 2: 36,869,878 V104A probably benign Het
Olfr621-ps1 A G 7: 103,629,183 L259P unknown Het
Olfr709-ps1 A T 7: 106,926,904 L185Q probably damaging Het
Olfr771 T A 10: 129,160,070 I305F probably benign Het
Olfr868 A T 9: 20,100,873 Y38F probably damaging Het
P2rx7 A T 5: 122,666,142 probably null Het
Pard3 A T 8: 127,593,092 I1149L probably damaging Het
Pcdha8 T A 18: 36,992,777 I104N probably damaging Het
Pgap2 A T 7: 102,210,567 probably benign Het
Phf7 T C 14: 31,241,788 R76G probably benign Het
Pigu T C 2: 155,299,170 T268A probably damaging Het
Piwil4 T C 9: 14,729,993 T231A possibly damaging Het
Pkd1l1 T G 11: 8,945,202 E636A Het
Plscr3 T C 11: 69,847,490 S55P unknown Het
Pnlip T A 19: 58,676,544 I268N probably damaging Het
Podxl A T 6: 31,524,994 H343Q probably benign Het
Prkcd T C 14: 30,605,836 T213A probably benign Het
Prss22 T A 17: 23,996,445 Q119L probably benign Het
Ptprcap A G 19: 4,156,239 E107G possibly damaging Het
Ptprg A G 14: 12,154,198 T640A possibly damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Rasa4 A G 5: 136,095,594 T166A probably benign Het
Sbf2 T C 7: 110,399,348 E626G possibly damaging Het
Scn2a T A 2: 65,682,506 Y203* probably null Het
Serpinb1a G C 13: 32,842,998 H320Q probably damaging Het
Shisa7 G A 7: 4,829,921 T464I probably benign Het
Slc47a2 G A 11: 61,308,873 A399V possibly damaging Het
Smim4 A G 14: 31,124,603 V53A probably damaging Het
Snrnp200 A G 2: 127,221,826 T642A probably benign Het
Spag16 A G 1: 69,844,367 H85R probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stag3 C A 5: 138,301,508 L894M probably damaging Het
Sun2 A T 15: 79,734,112 F284Y probably benign Het
Tpx2 T A 2: 152,876,630 N184K probably benign Het
Trpa1 A T 1: 14,898,110 N477K probably damaging Het
Ttbk2 C T 2: 120,790,310 R157H probably damaging Het
Ttn C T 2: 76,707,305 E34760K probably benign Het
Tysnd1 T C 10: 61,696,648 S360P probably damaging Het
Usp34 T A 11: 23,361,683 L511I probably damaging Het
Vmn2r71 A T 7: 85,624,260 T761S possibly damaging Het
Zdhhc18 G T 4: 133,633,171 C73* probably null Het
Zfp975 A T 7: 42,662,791 C133S probably damaging Het
Zfy1 T C Y: 735,141 E214G unknown Het
Zmym5 T A 14: 56,794,140 K504* probably null Het
Other mutations in Pecr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03124:Pecr APN 1 72277340 missense probably benign 0.04
R1556:Pecr UTSW 1 72259383 missense probably benign
R1711:Pecr UTSW 1 72277409 missense possibly damaging 0.93
R1882:Pecr UTSW 1 72274977 splice site probably null
R2150:Pecr UTSW 1 72277358 missense possibly damaging 0.73
R2507:Pecr UTSW 1 72261976 missense probably benign 0.11
R2516:Pecr UTSW 1 72277310 missense probably damaging 1.00
R3774:Pecr UTSW 1 72259371 missense probably benign 0.00
R3775:Pecr UTSW 1 72259371 missense probably benign 0.00
R3968:Pecr UTSW 1 72276309 missense probably damaging 0.99
R3969:Pecr UTSW 1 72276309 missense probably damaging 0.99
R3970:Pecr UTSW 1 72276309 missense probably damaging 0.99
R4171:Pecr UTSW 1 72276269 missense probably damaging 1.00
R4773:Pecr UTSW 1 72267435 missense probably damaging 1.00
R4864:Pecr UTSW 1 72277331 missense probably benign 0.35
R5191:Pecr UTSW 1 72274977 splice site probably null
R5259:Pecr UTSW 1 72277285 critical splice donor site probably null
R5331:Pecr UTSW 1 72274846 intron probably benign
R6828:Pecr UTSW 1 72267457 nonsense probably null
R7238:Pecr UTSW 1 72259433 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACATGGTTTGATGGCACTG -3'
(R):5'- CAGTCAGCATATCCCCTGATGC -3'

Sequencing Primer
(F):5'- GGCACTGAAATAATCTCTCTACTGG -3'
(R):5'- TGAGTTCTAGAGATGGGACCC -3'
Posted On2019-09-13